Expression of CD44 variant exons in acute myeloid leukemia is more common and more complex than that observed in normal blood, bone marrow or CD34+ cells

Bendall, Linda J.; Bradstock, Kenneth F.; Gottlieb, David

doi:10.1038/sj.leu.2401830

Cited by 49 publications

(27 citation statements)

References 37 publications

(32 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The CD44 isoform accounting for adhesion to the BM niche was not consistently evaluated. LIC adhesion to the BM niche may rely on an embryonic CD44v isoform (Holm et al, 2015) or may profit from CD44v expression (Bendall et al, 2000; Liu and Jiang, 2006; Redondo-Muñoz et al, 2010) or differ between leukemia subtypes as elaborated for CML-like myeloproliferative neoplasia and AML LIC, which use diverse mechanisms for niche embedding (Krause et al, 2013), the majority of LIC apparently compete with HSC for the BM niche via CD44s binding. CD44/HA also is engaged in CIC homing.…”

Section: Linking Cd44/cd44v6 Activities To Cic Featuresmentioning

confidence: 99%

CD44/CD44v6 a Reliable Companion in Cancer-Initiating Cell Maintenance and Tumor Progression

Wang

Zhao

Hackert

et al. 2018

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Metastasis is the leading cause of cancer death, tumor progression proceeding through emigration from the primary tumor, gaining access to the circulation, leaving the circulation, settling in distant organs and growing in the foreign environment. The capacity of a tumor to metastasize relies on a small subpopulation of cells in the primary tumor, so called cancer-initiating cells (CIC). CIC are characterized by sets of markers, mostly membrane anchored adhesion molecules, CD44v6 being the most frequently recovered marker. Knockdown and knockout models accompanied by loss of tumor progression despite unaltered primary tumor growth unraveled that these markers are indispensable for CIC. The unexpected contribution of marker molecules to CIC-related activities prompted research on underlying molecular mechanisms. This review outlines the contribution of CD44, particularly CD44v6 to CIC activities. A first focus is given to the impact of CD44/CD44v6 to inherent CIC features, including the crosstalk with the niche, apoptosis-resistance, and epithelial mesenchymal transition. Following the steps of the metastatic cascade, we report on supporting activities of CD44/CD44v6 in migration and invasion. These CD44/CD44v6 activities rely on the association with membrane-integrated and cytosolic signaling molecules and proteases and transcriptional regulation. They are not restricted to, but most pronounced in CIC and are tightly regulated by feedback loops. Finally, we discuss on the engagement of CD44/CD44v6 in exosome biogenesis, loading and delivery. exosomes being the main acteurs in the long-distance crosstalk of CIC with the host. In brief, by supporting the communication with the niche and promoting apoptosis resistance CD44/CD44v6 plays an important role in CIC maintenance. The multifaceted interplay between CD44/CD44v6, signal transducing molecules and proteases facilitates the metastasizing tumor cell journey through the body. By its engagement in exosome biogenesis CD44/CD44v6 contributes to disseminated tumor cell settlement and growth in distant organs. Thus, CD44/CD44v6 likely is the most central CIC biomarker.

show abstract

Section: Linking Cd44/cd44v6 Activities To Cic Featuresmentioning

confidence: 99%

CD44/CD44v6 a Reliable Companion in Cancer-Initiating Cell Maintenance and Tumor Progression

Wang

Zhao

Hackert

et al. 2018

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

show abstract

“…The adhesion molecule CD44 has been identified as a therapeutic target in AML due to its altered properties in AML blasts and association with poor prognosis and high relapse rates in AML as well as many solid tumors [14,15,[48][49][50][51][52]. Highly efficient blocking of CD44 was previously achieved using anti-CD44 moAb in AML and resulted in anti-tumor activity in leukemia xenografts [12]; however, the requirement of complex processes with high cost for therapeutic moAbs production and the possibility of adverse effects including immune reactions, infections, autoimmune diseases, cancer, platelet and thrombotic disorders, and cardiotoxicity by administration of moAbs are still major concerns [18][19][20][21].…”

Section: Discussionmentioning

confidence: 99%

“…In addition, CD44 was identified as a crucial surface receptor on BCR-ABL-positive LSPC of chronic myeloid leukemia (CML) involved in homing, migration and retention in the BM [13]. More importantly, clinical experience indicates that CD44 is associated with poor prognosis of AML, and high CD44 levels are associated with higher relapse rates [14,15]. In support of its crucial role in AML relapse, it has been recently reported that the high level expression of CD44 by AML cells was sufficient to generate leukemia by leukemia-initiating cells even after withdrawal of the HoxA10 gene overexpression event that initiated the leukemia [16].…”

Section: Introductionmentioning

confidence: 99%

Polymeric nanoparticle-mediated silencing of CD44 receptor in CD34+ acute myeloid leukemia cells

et al. 2014

View full text Add to dashboard Cite

“…Sequencing of v6-containing variant isoforms in bone marrow MNCs from APL patients Total RNA was extracted with TRIZOL (Invitrogen) and used for reverse transcription into cDNA. In the presence of DNA polymerase (Promega, Madison, WI, USA), PCR was performed using previously described procedures (LJ et al, 2000): pre-denaturation at 95°C for 5 min; 35 cycles of denaturation at 94°C for 50 s, annealing at 55°C for 30 s and extension at 72°C for 60 s followed by a final extension at 72°C for 10 min. The primers in the PCR were as follows: β-actin: 5'AGTGTGACGTGGACATCCGCAAAG3' (forward), 5'ATCCACATCTG CTGGAAGG TGGAC 3' (reverse); CD44S-v6: 5'TCCAGGCAACTCCTAGTA 3' (forward), 5'-AGTCCACTTGGCTTTCTGTC-3' (reverse); CD44v6-S: 5'-GACGAAGACAGTCCCTGGATCA-3' (forward), 5' CAGCTGTCCCTGTTGTCG3ʼ (reverse).…”

Section: Cell Culturementioning

confidence: 99%

Prognostic Significance of CD44v6/v7 in Acute Promyelocytic Leukemia

Chen

Huang²,

Lu³

et al. 2012

Asian Pacific Journal of Cancer Prevention

View full text Add to dashboard Cite

CD44v, especially splice variants containing exon v6, has been shown to be related closely to development of different tumors. High levels of CD44v6/v7 have been reported to be associated with invasiveness and metastasis of many malignancies. The objective of this study was to detect expression of CD44v6-containing variants in patients with acute promyelocytic leukemia (APL) and evaluate the potential of CD44v6/v7 for risk stratification. Reverse transcription polymerase chain reaction (RT-PCR) followed by PCR product purification, ligation into T vectors and positive clone sequencing were used to detect CD44 v6-containing variant isoforms in 23 APL patients. Real-time quantitative PCR of the CD44v6/v7 gene was performed in patients with APL and in NB4 cells that were treated with all-trans retinoic acid (ATRA) or arsenic trioxide (As 2 O 3 ). Sequencing results identified four isoforms (CD44v6/v7, CD44v6/v8/v10, CD44v6/v8/v9/v10, and CD44v6/v7/v8/v9/v10) in bone marrow mononuclear cells of 23 patients with APL. The level of CD44v6/v7 in high-risk cases was significantly higher than those with low-risk. Higher levels of CD44v6/v7 were found in three patients with central nervous system relapse than in other patients inthe same risk group. Furthermore, in contrast to ATRA, only As 2 O 3 could significantly down-regulate CD44v6/v7 expression in NB4 cells. Our data suggest that CD44v6/v7 expression may be a prognostic indicator for APL.

show abstract

Expression of CD44 variant exons in acute myeloid leukemia is more common and more complex than that observed in normal blood, bone marrow or CD34+ cells

Abstract: CD44 is an adhesion molecule that is expressed on hematopoietic cells and has been implicated in the interactions

Cited by 49 publications

References 37 publications

CD44/CD44v6 a Reliable Companion in Cancer-Initiating Cell Maintenance and Tumor Progression

CD44/CD44v6 a Reliable Companion in Cancer-Initiating Cell Maintenance and Tumor Progression

Polymeric nanoparticle-mediated silencing of CD44 receptor in CD34+ acute myeloid leukemia cells

Prognostic Significance of CD44v6/v7 in Acute Promyelocytic Leukemia

Contact Info

Product

Resources

About