Expression of genes kdsA and kdsB involved in 3-deoxy-D-manno-octulosonic acid metabolism and biosynthesis of enterobacterial lipopolysaccharide is growth phase regulated primarily at the transcriptional level in Escherichia coli K-12

Abstract

We have cloned and sequenced a cluster of six open reading frames containing gene kdsA from Escherichia coli K-12. The gene encodes 3-deoxy-D-manno-octulosonate 8-phosphate synthetase (KDO-8-phosphate synthetase), which catalyzes formation of 3-deoxy-D-manno-octulosonic acid (KDO), an essential component of enterobacterial lipopolysaccharide. We have also identified two other genes, hemA and prfA, at the beginning of the cluster. Deletion analysis shows that kdsA, the terminal gene of this putative operon, is transcribed from its own promoter located within the cluster rather than from two promoters preceding this group of six open reading frames. Northern (RNA) blot analysis as well as lacZ operon fusion experiments reveal that the expression of gene kdsA occurs maximally in the early log phase and falls to a low level in the late log and stationary phases. Hence, this gene is subjected to growth phase-dependent regulation at the transcriptional level. Similarly, we show that expression of gene kdsB, which codes for the CTP:CMP-3-deoxy-D-mannooctulosonate cytidyltransferase (CMP-KDO-synthetase), is also growth regulated. This enzyme catalyzes the activation of KDO via formation of CMP-KDO, which is necessary for the incorporation of KDO into lipid A. We have identified the promoter of gene kdsB, whose expression is growth regulated in the same way as that of kdsA. Despite the fact that transcription of genes kdsA and kdsB is shut off as cells enter stationary phase, KDO-8-phosphate synthetase as well as CMP-KDO-synthetase activities are still present at various levels during stationary-phase growth of an E. coli K-12 culture.A major component of the outer membrane of enterobacteria is lipopolysaccharide (LPS), the so-called endotoxin, which is responsible for the pathogenic properties of gramnegative bacteria (38). This macromolecule consists of two structural segments, the hydrophobic lipid A part and the hydrophilic core oligosaccharide chain to which the O-antigenic polysaccharide chains may be attached. Lipid A and the core oligosaccharides are linked through two or three molecules of the eight-carbon sugar 3-deoxy-D-manno-octulosonic acid (KDO) (31,38). KDO is an essential component of LPS. This is reflected by the fact that only conditionally lethal KDO biosynthesis mutants can be isolated (25,36,37). KDO is enzymatically synthesized in the cytoplasm in two steps, i.e., formation of KDO-8-phosphate by the condensation of Darabinose-5-phosphate and phosphoenol pyruvate and subsequent dephosphorylation by a specific phosphatase to give KDO. The enzymes involved in this biosynthetic pathway are 3-deoxy-D-manno-octulosonate 8-phosphate synthetase (KDO-8-phosphate synthetase) (32) and KDO-8-phosphate phosphatase (33). Subsequent incorporation into lipid A requires activation of KDO by CTP in a reaction catalyzed by the cytosolic enzyme CTP:CMP-3-deoxy-D-manno-octulosonate cytidyltransferase (CMP-KDO-synthetase) (17,34,35). KDO is finally incorporated into lipid A by a KDO-transferase(s) (7). KDO-8-phosphate sy...

The Gene Expression and Enzyme Activity of Plant 3-Deoxy-D-Manno-2-Octulosonic Acid-8-Phosphate Synthase Are Preferentially Associated with Cell Division in a Cell Cycle-Dependent Manner

“…After digestion, the PCR product subsequently was ligated into BamHI-XhoI restricted pBluescript vector (Stratagene) to generate the pBXLED26 plasmid. The E. coli kdsA promoter was PCR amplified from E. coli genomic DNA using the 5Ј-specific primer CTCCTCGGATCCGAACATATGCTGGACG and the 3Ј-specific primer CTCCTCGGATCCGCCTTAATCTTGAG introducing BamHI restriction sites upstream of nucleotides 5,906 to 5,921 and downstream of nucleotides 6,287 to 6,300 of the promoter sequence (Strohmaier et al, 1995). This 395-bp DNA fragment comprised the Ϫ35 and Ϫ10 promoter boxes and the Shine-Dalgarno sequence at its 3Ј end.…”

“…Protein extracts from the different S. enterica strains were prepared according to Strohmaier et al (1995). Protein extracts from tomato plant tissues (leaves and fruits at various developmental stages) were prepared as follows.…”

A Genome‐Scale Modeling Approach to Quantify Biofilm Component Growth of Salmonella Typhimurium

“…LPS is the major component of the surface of gram‐negative bacteria, and the close relationship between the presence of LPS and biofilm formation has been reported in S. typhimurium (Mireles and others ) and E. coli (Nakao and others ). 3‐Deoxy‐D‐manno‐oct‐2‐ulosonic acid (KDO) is an essential component of enterobacterial LPS (Strohmaier and others ), and interference in the KDO pathway leads to diminished LPS production and growth (Tan and Darby ). GutQ was discovered to play an important role in LPS biosynthesis (Meredith and Woodard ) and biofilm formation (Herzberg and others ), which is an arabinose 5‐phosphate isomerase that converts ribulose 5‐phosphate into arabinose 5‐phosphate, an essential step in the initiation of the KDO pathway (Tan and Darby ).…”

kdsA mutations affect FtsZ-ring formation in Escherichia coli K-12

“…E. coli kdsA, however, was first identified as a gene complementing the kdsA mutation of Salmonella (Woisetschla$ ger & Ho$ genauer, 1987) typhimurium cause the accumulation of lipid A in the periplasm, also resulting in the disappearance of LPS from the outer membrane Osborn et al, 1980). LPS is an essential membrane component (Strohmaier et al, 1995) and only conditional lethal mutants in KDO biosynthesis can be isolated in Salmonella (Lehmann et al, 1977 ;Rick & Young, 1982). The biosynthesis of LPS is growth-phase-regulated at the transcriptional level in E. coli (Strohmaier et al, 1995) ; no evidence, however, has uncovered a relationship between LPS biosynthesis and cell division.…”

“…LPS is an essential membrane component (Strohmaier et al, 1995) and only conditional lethal mutants in KDO biosynthesis can be isolated in Salmonella (Lehmann et al, 1977 ;Rick & Young, 1982). The biosynthesis of LPS is growth-phase-regulated at the transcriptional level in E. coli (Strohmaier et al, 1995) ; no evidence, however, has uncovered a relationship between LPS biosynthesis and cell division. In this study, we isolated temperaturesensitive mutants of kdsA and demonstrated that membrane instability resulting from the defect in KDO biosynthesis affected the FtsZ-ring formation.…”