Expression of TLR-4 in <i>Salmonella typhi</i>-Induced Balb/c Mice Treated by Miana Leaves (<i>Coleus scutellaroides</i> (L) Benth)

Syamsuri, Fadhilah; Hatta, Mochammad; Natzir, Rosdiana; Alam, Gemini; Massi, Maurizio; Bahar, Burhanuddin; Rahardjo, Sutji Pratiwi

doi:10.5958/0976-5506.2018.02057.0

Cited by 13 publications

(10 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Various microbes possess pathogen-associated molecular pattern (PAMP) receptors that are recognized by pattern recognition receptors (PRRs) through cell wall components that subvert different microbes [14] . TLRs are very important PRRs of immune system required to initiate an effective innate immune response at an early stage of infection and inflammation [14] , [15] , [16] . Monocytes/Macrophages, Dendritic Cells (DC), and neutrophils have Toll-like receptor (TLR) 2 and 4 at their surfaces.…”

Section: Introductionmentioning

confidence: 99%

Comparison TLR2 and TLR4 serum levels in children with pulmonary and extrapulmonary tuberculosis with and without a Bacillus Calmette-Guérin (BCG) scar

Shabariah

Hatta

Idris

et al. 2021

Journal of Clinical Tuberculosis and Other Mycobacterial Diseas

Self Cite

View full text Add to dashboard Cite

The formation of a scar after Mycobacterium bovis Bacillus Calmette-Guérin ( BCG) vaccination influences the effectiveness of protection against Mycobacterium tuberculosis (MTB) infection. The innate immunity plays a critical role both in the pathophysiology of tuberculosis (TB) and BCG vaccination protection mechanism. Parts of innate immunity: macrophages, dendritic cells, and neutrophils, have microbial recognition surface receptors called Toll-like receptors (TLR) 2 and 4. The objective of this study is to compare the serum levels of TLR2 and TLR4 in BCG-vaccinated pediatric patients with pulmonary and extrapulmonary TB. This cross-sectional study included children aged less than 18 years old with contracted TB disease and had received BCG vaccination. The subjects were recruited by convenience sampling from both outpatient and inpatient care at Bhakti Medicare and Jakarta Islamic Hospital, from November 2018 to December 2019. Serum TLR2 and TLR4 levels measured using ELISA of the two groups of subjects: children with pulmonary TB (PTB) and extrapulmonary TB (EPTB), were then compared. The presence of BCG scars was included in the analysis. Independent T-test, ANOVA test, and Kolmogorov-Smirnov normality tests on the SPSS program were used to statistically analyze the results. Serum TLR2 and TLR4 levels were higher in EPTB group, but the difference was not significant (TLR2 p = 0.758 and TLR4 p = 0.646, respectively). Subjects with BCG scars in both groups have significantly higher serum TLR2 and TLR4 levels than those without BCG scars in the EPTB group (EPTB p = 0.001 and p = 0.004, respectively); (PTB p < 0.001 and p < 0.001, respectively). BCG vaccination and MTB infection stimulate better innate immune response in EPTB than in PTB and serum TLR2 and TLR4 levels in those with BCG scars were higher when compared to those without BCG scars.

show abstract

Section: Introductionmentioning

confidence: 99%

Comparison TLR2 and TLR4 serum levels in children with pulmonary and extrapulmonary tuberculosis with and without a Bacillus Calmette-Guérin (BCG) scar

Shabariah

Hatta

Idris

et al. 2021

Journal of Clinical Tuberculosis and Other Mycobacterial Diseas

Self Cite

View full text Add to dashboard Cite

show abstract

“…Previous study was conducted a study on animal model of Salmonella typhi infection treated with miana leaf extract showing increasing of TLR4 expression [ 11 ]. Amsyah et al conducted a study using miana leaf extract in rat induced Aggregatibacter actinomycetemcomitans was found significantly effect had the same effect as levofloxacin on IL-10 mRNA expression [ 12 ].…”

Section: Discussionmentioning

confidence: 99%

“…Previously, study revealed that the effect of immunomodulator and immune responses on Miana leaves for infectious diseases [ [11] , [12] , [13] ]. Immunomodulator parameter such as T lymphocyte, CD4 T cell, IFN-γ and TNF-α and other cytokines were measured after herbal medicine treated in infection of human and animal model [ [14] , [15] , [16] ].…”

Section: Introductionmentioning

confidence: 99%

Increasing Natural Resistance Associated Macrophage Protein 1 serum level after Miana treatment in BALB/c induced Klebsiella pneumoniae experimental research

Wahyuni

Hatta

Bukhari

et al. 2021

Annals of Medicine &Amp; Surgery

Self Cite

View full text Add to dashboard Cite

Background Miana ( Coleus Scutellariodes [L] Benth) inhibits growth of bacterial pathogen inside macrophage. Objective The aim of this study is to determine the protein level of Natural Resistance Associated Macrophage Protein 1 (NRAMP1), after administration of Miana extracts in BALB/c mice induced Klebsiella pneumoniae . Methods This is an experimental study using animal model with post test-only controlled group design. Twenty healthy adult male BALB/c mice were randomly divided into four groups, negative control group (distilled water), Levofloxacin 100 mg/kg, injection intraperitoneal, first treatment group (Miana leaves extract/MLE 510 mg/kg) and second treatment group (Miana + levofloxacin). MLE were administered via gastric gavage for ten consecutive days. The blood was drawn from each mice on the first day, on the eight day of experiment (2 h after treatment), and at 10 days. The blood sample was examined by ELISA to determine the NRAMP1 protein level. Analysis of the number of lung tissue bacteria used Plate count agar to see the growth of Klebsiella pneumonia . Results NRAMP1 protein level in BALB/c mice after administration of Miana extract was increased significantly in after 10 days treatment (p < 0.0001). The highest increasing in protein levels was found in treatment group (Miana + levofloxacin) with an increase before treatment 3036,07 to 10010,30 pg/ml after treatment p < 0,0001. Conclusion NRAMP1 protein level in BALB/c mice were highest increasing in protein levels after administration of Miana extract and Levofloxacin compared Miana or Levofloxacin only and clinical impact proved a comparable effect on suppressing Klebsiella pneumoniae growth. The institutional protocol number of this study is 1010/UN4.6.4.5.31/PP36/2019.

show abstract

“…Primer for mice mRNA TLR4 is TLR4-forward: TGACAGGAAACCCTATCCAGAGTT and TLR4-reverse: TCTCCACAGCCACCAGATTCT. [ 14 ]…”

Section: Methodsmentioning

confidence: 99%

Effects of lime (Citrus aurantifolia) peel to the expression of mRNA toll-like receptors 4 in balb/c mice-infected Salmonella typhi

Kasim

Hatta

Natzir

et al. 2020

J Adv Pharm Technol Res

Self Cite

View full text Add to dashboard Cite

Expression of TLR-4 in Salmonella typhi-Induced Balb/c Mice Treated by Miana Leaves (Coleus scutellaroides (L) Benth)

Cited by 13 publications

References 0 publications

Comparison TLR2 and TLR4 serum levels in children with pulmonary and extrapulmonary tuberculosis with and without a Bacillus Calmette-Guérin (BCG) scar

Comparison TLR2 and TLR4 serum levels in children with pulmonary and extrapulmonary tuberculosis with and without a Bacillus Calmette-Guérin (BCG) scar

Increasing Natural Resistance Associated Macrophage Protein 1 serum level after Miana treatment in BALB/c induced Klebsiella pneumoniae experimental research

Effects of lime (Citrus aurantifolia) peel to the expression of mRNA toll-like receptors 4 in balb/c mice-infected Salmonella typhi

Contact Info

Product

Resources

About