Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Abstract

Fertilization is accompanied by the construction of an extracellular matrix that protects the new zygote. In sea urchins, this structure is built from glycoproteins residing at the egg surface and in secretory vesicles at the egg cortex. Four enzymatic activities are required for the transformation of these proteins into the mechanically and chemically resilient fertilization envelope: proteolysis, transamidation, NADPH-dependent oxidation and peroxidation. Here, we identify the Strongylocentrotus purpuratus enzymes responsible for the formation of ε(γ-glutamyl)lysine crosslinks (transamidation). We find that these two transglutaminases are activated by local acidification and act on specific substrates within the fertilization envelope (including ovoperoxidase, rendezvin and SFE9). Surprisingly, these enzymes also regulate dityrosine crosslinking both by direct conjugation of ovoperoxidase and by modulating hydrogen peroxide production. Together, these results emphasize how transglutaminases can coordinate the activities of other enzymes during extracellular matrix transmogrifications. Development 136, 1835Development 136, -1847Development 136, (2009Development 136, ) doi:10.1242 Department of Molecular Biology, Cell Biology, and Biochemistry, Box G-L173, 185 Meeting Street, Brown University, Providence, RI 02912, USA. KEY WORDS: Extracellular matrix, Fertilization, Transamidation, Transglutaminase, Sea urchin*Author for correspondence (e-mail: rhet@brown.edu) Accepted 9 March 2009 DEVELOPMENT MATERIALS AND METHODS AnimalsStrongylocentrotus purpuratus gametes were obtained and handled as previously described . RNA in situ hybridizationAntisense digoxigenin-labeled RNA probes (DIG RNA Labeling Kit (SP6/T7); Roche Diagnostics Corporation, Indianapolis, IN, USA) representing S. purpuratus eTG (nucleotides 1274 to 1802) and nTG (nucleotides -62 to 403) or negative control probe (neomycin phosphotransferase II) were used at 0.1 μg probe/ml to detect native transcript in oocytes according to previously published protocols (ArenasMena et al., 2000). Quantitative PCRReal-time quantitative PCR was conducted on about 0.1 μg-equivalents of total RNA isolated from hand-collected oocytes or eggs (Song et al., 2006). Primers representing the 3Ј-end of each transglutaminase open reading frame were used to amplify products for eTG (199 bp using F=5Ј CACT-GAGGATTTGATGGTTGG with R=5Ј GGTTGCCTGTCTTCTTTGGT) and nTG (169 bp using F=5Ј CCACCGGAGATGAAGACTGA with R=5Ј TTGCCCTTTGAAGGAACATC), and cycle numbers were normalized to ubiquitin (~147 bp using F=5Ј CACAGGCAAGACCATCACAC; R=5Ј GAGAGAGTGCGACCATCCTC). Each PCR reaction was run off of cDNA (TaqMan Reverse Transcription kit; Applied Biosystems, Foster City, CA, USA) using Platinum SBYR Green qPCR SuperMix-UDG with ROX (Invitrogen Corporation, Carlsbad, CA, USA) on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Production of polyclonal antiseraAntiserum was raised in rabbits against bacterially overexpressed, recombinant fragments subcloned downstream of ...

Cell surface changes in the egg at fertilization

“…Activation of the enzyme appears to come from a rapid and transient pH shift—a result of the acid released from the cell cortex to the surface of the egg (Johnson and Epel, 1976; Smith et al, 2002). When this acidification is mimicked in vitro, a substantial increase in transamidation that closely matches the in vivo pattern is observed (Wong and Wessel, 2009). This shift is unlike the activation steps observed for other, classic transglutaminases such as mammalian factor XIII, activated by proteolysis and involved in blood clotting, or transglutaminase type I, activated by calcium and utilized by epidermal keratinocytes to establish keratin polymers (Lorand and Graham, 2003; Candi et al, 2005; Esposito and Caputo, 2005).…”

“…This is deduced from studies in which eggs can be activated in media at pH 5, and the protein interactions necessary for FE formation function quite normally (Haley and Wessel, 2004a). The third enzyme affected by the pH shift is transglutaminase, which is briefly activated by the local acidification outside the plasma membrane (Wong and Wessel, 2009). This short burst of cross-linking activity may regulate other enzymes required for egg activation, and may promote the FEs assembly.…”

“…These covalent bonds are generally irreversible, and are regulated by substrate availability, nucleotides, and/or calcium depending on the transglutaminase isoform (Lorand and Graham, 2003). The sea urchin contains two transglutaminases, and the extracellular isoform (eTG) is the main one responsible for cross-linking proteins of the FE (Wong and Wessel, 2009). Activation of the enzyme appears to come from a rapid and transient pH shift—a result of the acid released from the cell cortex to the surface of the egg (Johnson and Epel, 1976; Smith et al, 2002).…”

Potential roles of transglutaminase and thioredoxin in the release of gonad-stimulating factor in Penaeus monodon: Implication from differential expression in the brain during ovarian maturation cycle

“…TGase was shown to be essential for the uptake of vitellogenin by Xenopus oocytes via a receptor-mediated endocytosis (Tucciarone and Lanclos, 1981). In sea urchin, TGase plays role as a key enzyme in the modification of egg extracellular matrix upon fertilization (Wong and Wessel, 2009). In crustacean, however, TGase has been mainly reported for its involvement in immune defense against both bacteria and viruses (Yeh et al, 2009;Prapavorarat et al, 2010).…”

High Throughput Microinjections of Sea Urchin Zygotes

“…They produce a large number of synchronously developing transparent embryos that can be easily manipulated. Using sea urchin as a model organism, the sea urchin community has contributed to our understanding of the fertilization process [18][19][20][21] , cell biological processes [22][23][24] , and the gene regulatory networks (GRNs) [25][26][27][28] .…”