Extreme differences in SLCO1B3 functional polymorphisms in Roma and Hungarian populations

Nagy, Ágnes; Szalai, Renáta; Magyari, Lili; Bene, Judit; Tóth, Kálmán; Melegh, Béla

doi:10.1016/j.etap.2015.04.019

Cited by 5 publications

(6 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reports from Bulgaria [ 5 , 6 , 7 ], Spain [ 8 , 9 ], Slovakia [ 10 , 11 ], Slovenia [ 12 , 13 ], Serbia [ 14 ], Belgium [ 15 ] and England [ 16 , 17 , 18 ] apply this approach. Furthermore, this research attitude is also reflected in Hungarian publications on the health status [ 19 , 20 , 21 , 22 ] and genetic susceptibility [ 23 , 24 , 25 , 26 ] of the Roma people. Due to the fluidity of self-reported identity, which is influenced by societal attitudes, self-reported Roma classification is considered an approximation, which underestimates the proportion of Roma persons and leads to biased results [ 27 ].…”

Section: Introductionmentioning

confidence: 87%

Is the Definition of Roma an Important Matter? The Parallel Application of Self and External Classification of Ethnicity in a Population-Based Health Interview Survey

Janka

Vincze

Ádány

et al. 2018

IJERPH

View full text Add to dashboard Cite

The Roma population is typified by a poor and, due to difficulties in ethnicity assessment, poorly documented health status. We aimed to compare the usefulness of self-reporting and observer-reporting in Roma classification for surveys investigating differences between Roma and non-Roma populations. Both self-reporting and observer-reporting of Roma ethnicity were applied in a population-based health interview survey. A questionnaire was completed by 1849 people aged 18–64 years; this questionnaire provided information on 52 indicators (morbidity, functionality, lifestyle, social capital, accidents, healthcare use) indicators. Multivariate logistic regression models controlling for age, sex, education and employment were used to produce indicators for differences between the self-reported Roma (N = 124) and non-Roma (N = 1725) populations, as well as between observer-reported Roma (N = 179) and non-Roma populations (N = 1670). Differences between interviewer-reported and self-reported individuals of Roma ethnicity in statistical inferences were observed for only seven indicators. The self-reporting approach was more sensitive for two indicators, and the observer-reported assessment for five indicators. Based on our results, the self-reported identity can be considered as a useful approach, and the application of observer-reporting cannot considerably increase the usefulness of a survey, because the differences between Roma and non-Roma individuals are much bigger than the differences between indicators produced by self-reported or observer-reported data on individuals of Roma ethnicity.

show abstract

Section: Introductionmentioning

confidence: 87%

Is the Definition of Roma an Important Matter? The Parallel Application of Self and External Classification of Ethnicity in a Population-Based Health Interview Survey

Janka

Vincze

Ádány

et al. 2018

IJERPH

View full text Add to dashboard Cite

show abstract

“…The genomic DNA was isolated from 3 to 4 ml of blood utilizing the phenol‐chloroform extraction technique. The genotype of variations was determined using the PCR‐PFLP method as previously mentioned 10,21,22 . For amplifying a DNA fragment for the SLC19A1 ( G 80 A , rs1051266) polymorphisms, the ensuing sets of primers were utilized such as 5′‐AGTGTCACCTTCGTCCCCTC‐3′ (sense) and 5′‐CTCCCGCGTGAAGTTCTT‐3′ (anti‐sense).…”

Section: Methodsmentioning

confidence: 99%

“…The genotype of variations was determined using the PCR-PFLP method as previously mentioned. 10,21,22 For amplifying a DNA fragment for the SLC19A1 (G 80 A, rs1051266) polymorphisms, the ensuing sets of primers were utilized such as 5 0 -AGTGTCACCTTCGTCCCCTC-3 0 (sense) and 5 0 -CTCCC GCGTGAAGTTCTT-3 0 (anti-sense). For SLCO1B1 A 388 G in exon 4 (rs2306283), the set of primers used was forward primer 5 0 -ATAATGGTGCAAATAAAGGGG-3 0 and reverse primer 5 0 -ACTATCTC AGGTGATGC TCTA-3 0 and for SLCO1B1 T 521 C(rs4149056) polymorphism, subsequent sets of primers were utilized such as 5 0 -TTGTCAAAGTTTG-CAAAGTG-3 0 (sense) and 5 0 -GAAGCATATTAC-CCATGAGC-3 0 (antisense).…”

Section: Genotypic Evaluation Of Slc Variantsmentioning

confidence: 99%

“…19 For A 1683-5676 G, a PCR amplicon of 286 bp was subjected to restriction digestion with 5U of Rsa I (New England Biolabs) at 37 C. The wild type allele (AA) yielded bands of 262, 24 bp, variant allele (GG) were identified by 155, 107, 24 bp, while heterozygous showed all the fragments (Figure 1d). 22 Fragments digested with respective enzymes were separated on 8% Native-polyacrylamide gel electrophoresis (PAGE) and were subjected to stain with the ethidium bromide (EtBr) and were visualized with the help of UV trans-illuminator. Two separate people looked into the data to eliminate any potential biases, and 20% of the samples were chosen at random, ensuring that the outcomes were 100% reproducible.…”

Section: Genotypic Evaluation Of Slc Variantsmentioning

confidence: 99%

See 1 more Smart Citation

Polymorphisms in solute carrier genes ( SLC19A1 , SLCO1B1 , and SLCO1B3 ) predicts survival and toxicity in North Indian lung cancer patients undergoing platinum‐based doublet chemotherapy

Sharma

Singh

Sharma

2022

Clinical Pharmacy Therapeu

View full text Add to dashboard Cite

What is Known and Objective Solute Carrier (SLC) transporters are known mediators of drug disposition that facilitate the influx of substrates and various chemotherapeutic agents into cells. Polymorphisms in the SLC19A1, SLCO1B1, and SLCO1B3 gene influence the prognosis in the cancer patients, but little is known about their role in lung cancer in Asians. So, the current study aims to investigate the polymorphisms in SLC19A1, SLCO1B1, and SLCO1B3 genes in Northern Indian lung cancer patients. Methods Patients with lung cancer who had a confirmed histology and cytology diagnosis were enrolled in the study. SLC polymorphisms were assessed by Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism (PCR‐RFLP) for variations in SLC19A1 (G80A), SLCO1B1 (A388G, T521C), and SLCO1B3 (A1683‐5676G). Results and Discussion Our results showed that mutant genotype for SLC19A1 G80A polymorphism had higher median survival time (MST) compared to wild genotype. ADCC patients with mutant genotype showed better survival compared to wild genotype for SLC19A1 G80A. SCLC patients G80A polymorphism showed increased survival in patients with mutant genotype (p = 0.04). In SLCO1B3, A1683‐5676G patients carrying heterozygous alleles and administered with platinum and docetaxel showed inferior survival (p = 0.006). In T521C variant, patients with carrier genotype had reduced chances of developing anaemia (p = 0.04). Patients with SLC19A1 and SLCO1B3 variants showed lower incidence of thrombocytopenia and nephrotoxicity. What is New and Conclusion Our findings imply that Solute Carrier gene polymorphisms modulate the overall survival in lung cancer patients undergoing platin‐based doublet chemotherapy, also these polymorphisms have a modifying impact on the associated adverse events/toxicity.

show abstract

“…The genotype of variations was determined using the PCR-PFLP method as previously mentioned. 10,19,20 For amplifying a DNA fragment for the SLC19A1 (G 80 A , rs1051266) variant following sets of primers were used: forward primer 5'-AGTGTCACCTTCGTCCCCTC-3' and reverse primer 5'-CTCCCGCGTGAAGTTCTT-3'.…”

Section: Genotyping Of Slc Variantsmentioning

confidence: 99%

Association between genetic polymorphisms in SLC19A1, SLCO1B1 and SLCO1B3 genes predicts survival and toxicity in North Indian lung cancer patients undergoing platinum-based doublet chemotherapy

Sharma,

Singh,

Sharma

2024

Preprint

View full text Add to dashboard Cite

Aims: SLC transporters are expressed in lungs and are essential membrane proteins responsible for the transport of wide range of chemotherapeutic drugs. Polymorphisms in SLC19A1, SLCO1B1, and SLCO1B3 gene in North Indian lung cancer patients are investigated. Methods: A total of 610 lung cancer patients undergoing platinum-based chemotherapy were recruited in the study. Polymorphisms of SLC19A1 (G80A), SLCO1B1 (A388G, T521C) and SLCO1B3 (A1683-5676G) in North Indian lung cancer patients were assessed and statistical analysis were carried out. Results: Our data revealed that patients harboring mutant genotype (AA) for SLC19A1 G80A polymorphism had higher MST as compared patients with wild type (GG) genotype (MST=9.33 versus 8.23). ADCC patients with mutant genotype (AA) showed better survival outcomes for SLC19A1 G80A (MST=9.4 versus 8.8, HR=0.6; p=0.04). In SCLC, SLC19A1 G80A polymorphism revealed increased survival in the patients harboring mutant genotype (AA) (MST=9.6 months versus 7.6 months, p=0.04). For SLCO1B3 polymorphism, patients administered with carboplatin/cisplatin and docetaxel showed inferior survival outcomes in subjects carrying heterozygous alleles (AG) (MST=2.9 months versus 9.6 months, p=0.006, HR=14.01). For anemia, SLCO1B1 T521C showed that patients with heterozygous genotype (TC) had a reduced risk of developing anemia (OR=0.44, 95% CI=0.20-0.96; p=0.04). Patients with SLCO1B1 A388G polymorphism harboring AG alleles was associated with a lower incidence of thrombocytopenia (OR=0.41, 95% CI=0.20-0.82; p=0.01). Patients with heterozygous (AG) genotype (OR=0.35, 95% CI=0.17-0.72; p=0.002) for A1683-5676G polymorphism showed lower incidence of nephrotoxicity. Conclusion: Genotyping of SLC polymorphism is crucial for predicting survival and toxicity in lung cancer patients undergoing platinum-based chemotherapy.

show abstract

Extreme differences in SLCO1B3 functional polymorphisms in Roma and Hungarian populations

Cited by 5 publications

References 30 publications

Is the Definition of Roma an Important Matter? The Parallel Application of Self and External Classification of Ethnicity in a Population-Based Health Interview Survey

Is the Definition of Roma an Important Matter? The Parallel Application of Self and External Classification of Ethnicity in a Population-Based Health Interview Survey

Polymorphisms in solute carrier genes ( SLC19A1 , SLCO1B1 , and SLCO1B3 ) predicts survival and toxicity in North Indian lung cancer patients undergoing platinum‐based doublet chemotherapy

Association between genetic polymorphisms in SLC19A1, SLCO1B1 and SLCO1B3 genes predicts survival and toxicity in North Indian lung cancer patients undergoing platinum-based doublet chemotherapy

Contact Info

Product

Resources

About