Facile Purification of Highly Active RecombinantStaphylococcus hyicusLipase Fragment and Characterization of a Putative Lid Region

Chang, Rey-Chang; Chen, Jack Chien; Shaw, Jei‐Fu

doi:10.1006/bbrc.1996.1730

Cited by 5 publications

(2 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2A). They were constructed by site-directed mutagenesis using a double-PCR method (4). For the construction of pICN18, the first PCR fragment was synthesized from the pICF4 template by primers IC2 (5Ј-AATTA AACACTAAAGATGTCTGGAACTGGAACGATGGTTCGGAGGAGA) and BS26 (5Ј-CCTTCTCGAGTCAACTGGTTGGCGCACG) followed by the second PCR using pICF4 as a template with primer BS19 (5Ј-TGCCTGCAGT AATACGACTCACTATAGAAAACTCACCGCAACGA) and the first PCR fragments.…”

Section: Methodsmentioning

confidence: 99%

Generation of Subgenomic RNA Directed by a Satellite RNA Associated with Bamboo Mosaic Potexvirus: Analyses of Potexvirus Subgenomic RNA Promoter

Lee

Hsu

Lin

2000

J Virol

View full text Add to dashboard Cite

Satellite RNA of bamboo mosaic potexvirus (satBaMV), a single-stranded positive-sense RNA encoding a nonstructural protein of 20 kDa (P20), depends on bamboo mosaic potexvirus (BaMV) for replication and encapsidation. A full-length cDNA clone of satBaMV was used to examine the sequences required for the synthesis of potexvirus subgenomic RNAs (sgRNAs). Subgenomic promoter-like sequences (SGPs), 107 nucleotides (nt) upstream from the capsid protein (CP) gene of BaMV-V, were inserted upstream of the start codon of the P20 gene of satBaMV. Insertion of SGPs gave rise to the synthesis of sgRNA of satBaMV in protoplasts of Nicotiana benthamiana and leaves of Chenopodium quinoa when coinoculated with BaMV-V genomic RNA. Moreover, both the satBaMV cassette and its sgRNA were encapsidated. From analysis of the SGPs by deletion mutation, we concluded that an SGP contains one core promoterlike sequence (nt ؊30 through ؉16), two upstream enhancers (nt ؊59 through ؊31 and ؊91 through ؊60), and one downstream enhancer (nt ؉17 through ؉52), when the transcription initiation site is taken as ؉1. Site-directed mutagenesis and compensatory mutation to disrupt and restore potential base pairing in the core promoter-like sequence suggest that the stem-loop structure is important for the function of SGP in vivo. Likewise, the insertion of a putative SGP of the BaMV open reading frame 2 gene or a heterologous SGP of potato virus X resulted in generation of an sgRNA. The satBaMV cassette should be a useful tool to gain insight into sequences required for the synthesis of potexvirus sgRNAs.The production of subgenomic RNAs (sgRNAs) is one of the strategies by which internally located open reading frames (ORFs) of multicistronic RNA virus may be expressed and regulated during replication. The capsid proteins (CPs) of alpha-like superfamily viruses are expressed by sgRNA transcription (24). The proteins encoded by the triple gene block of potex-, carla-, furo-, and hordeiviruses and the movement proteins of tobamo-and tombusviruses are also expressed by the same strategy (24). Several mechanisms are proposed for the transcription of sgRNAs. The first is leader-primed transcription, which occurs in the production of coronavirus sgRNAs. This process involves fusion of noncontinuous sequences from the 5Ј leader sequences to the sgRNA by a discontinuous process (14). Recently, a new model for coronavirus transcription was proposed. This model predicts that subgenome-length negative strands containing the common 5Ј leader sequence were directly derived from genome RNA and served as a template for the production of sgRNA (27). The second mechanism proposed for transcription of sgRNAs is exemplified by transcription of RNA-mediated trans-activation. A 34-nucleotide (nt) trans-activator on red clover necrotic mosaic virus RNA2 was proposed to bind to the element upstream of the sgRNA initiation site on RNA1 and to prevent the synthesis of full-length minus-strand RNA1. This truncated minus-strand RNA1 may serve as a template for viral RNA-depen...

show abstract

Section: Methodsmentioning

confidence: 99%

Generation of Subgenomic RNA Directed by a Satellite RNA Associated with Bamboo Mosaic Potexvirus: Analyses of Potexvirus Subgenomic RNA Promoter

Lee

Hsu

Lin

2000

J Virol

View full text Add to dashboard Cite

show abstract

“…The conformational changes around the lid control the enzyme activity of the lipase. The open conformation of lid allows substrates to reach the active site residues which are otherwise not accessible in the closed conformation [23][24][25][26][27]. Open conformation of PPL could be stabilized by either ionic/non-ionic detergents or bile salts in aqueous solution.…”

Section: Introductionmentioning

confidence: 99%

Lid closure dynamics of porcine pancreatic lipase in aqueous solution

Haque

Prabhu

2016

Biochimica et Biophysica Acta (BBA) - General Subjects

View full text Add to dashboard Cite

Facile purification of a C‐terminal extended His‐tagged Vibrio mimicus arylesterase and characterization of the purified enzyme

Lee

Chang

Shaw

1997

J Americ Oil Chem Soc

View full text Add to dashboard Cite

lrlgliluI[.' [If B(atany, ,'M adernia Sinica, Nankang,1 ,'.iplg, raiv,,,u~ 11 ~2!l, drlr, J /'D(?raarml(,t11 i.~r St,lld lel/hr~ologv, Td.illl.,i, Ta!wan ]11 ABSTRACT: ViJlrio mimicu,~ arylesterase, a 20 kDa protein, is a nlultiiuln~ tifma] enzyme with Ihioe,qer,tse at:<] chyl~qntl-yl)sin-like activilies, gecaLise an aflinily His-tag ,:six consecutive his{idin0 affinily' tag:l clirectly, [o the prnh.qn cau,4~d Ihe loss of enzyllq[? aLtivity, a hr,.,xade(-a]X':l::.tide v,.,itl'. His-tag, A1)I'NSSSVf)K1.AAAL.r_-HHH1-]HH encoded from vector pET-2Ob,:+i was (.iJllS]l-Ut:l(xt [{I ,Pxlen(J (mnl the carboxyl tr,_'lnlil~uls of the arvlesterase. This His. taggell pr~lein r,~:,[a]rqr,.,.(] enzyme fLJn,r..-ti,r'l~,S. Thermal unroh-ling l>e. hm,.'i[~r ol l~oIh proteins was ahnosl identical, and lheir T vakles were near 54:>(.7 as rnonilored 1),,. cilr.:ular dicl:,loism. l-ryl:>tic ,: le,tvage of lhe I'un~:tiemal His-tagged enzyme fm~du,:ed 1,a.'o smaller i)rGeins, which slill i~{~ssessed enZynlC a(_livily and whi{ h suggeslt.,ct [hal the addilii~na] ]leptide extended ~)n the i:~rotc.in ~t_tr'-Iat:e. fl',tt spa( htg pepfide hetweerl His-tag and arylesterase successlullv FXeVenle,d tl'i{, iNlerr'erulce of lhe His-tag to the enzyme functions. lhu kh~,:,li,: sludies sh(),,.ve~l ~l~( the wild q,'pe. /A(.)C5 74. 1}7l-1:176,:1 !;97).

show abstract

Facile Purification of Highly Active RecombinantStaphylococcus hyicusLipase Fragment and Characterization of a Putative Lid Region

Cited by 5 publications

References 0 publications

Generation of Subgenomic RNA Directed by a Satellite RNA Associated with Bamboo Mosaic Potexvirus: Analyses of Potexvirus Subgenomic RNA Promoter

Generation of Subgenomic RNA Directed by a Satellite RNA Associated with Bamboo Mosaic Potexvirus: Analyses of Potexvirus Subgenomic RNA Promoter

Lid closure dynamics of porcine pancreatic lipase in aqueous solution

Facile purification of a C‐terminal extended His‐tagged Vibrio mimicus arylesterase and characterization of the purified enzyme

Contact Info

Product

Resources

About