Fast-tracking development of homozygous transgenic cereal lines using a simple and highly flexible real-time PCR assay

Abstract

BackgroundA crucial step in the evaluation of newly produced transgenic plants is the selection of homozygous plants. Here we describe an efficient and highly flexible real-time PCR-based method for the development of homozygous lines in plant models with complex (multiple) genomes and/or relatively long generation times (>3 months) using direct copy number determinations.ResultsAn existing DNA extraction method was converted into a high-throughput plant leaf DNA extraction procedure yielding DNA suitable for real-time PCR analyses. Highly specific and efficient primer pairs were developed for a bread wheat reference gene (Epsilon Cyclase) and for standard sequence elements in the gene cassette routinely used for cereal transformations (an intron bridge and the Nopaline Synthase terminator). The real-time PCR assay reliably distinguished wheat plants with a single copy of the transgene from individuals with multiple copies or those lacking the transgene. To obtain homozygous lines carrying a unique insertion event as efficiently as possible, T0 plants (plants raised from transformed callus) with a single copy of the transgene were selected and their progeny screened for homozygous plants. Finally, the assay was adapted to work on rice.ConclusionsThe ability to quickly, easily and accurately quantify the construct copy numbers, as provided by the real-time PCR assay, greatly improved the efficiency and reliability of the selection of homozygous transgenic plants in our case study. We were able to select homozygous plants in early generations, avoiding time-consuming methods such as large scale analysis of segregation patterns of descendants and/or Southern blotting. Additionally, the ability to specifically develop homozygous lines carrying a unique insertion event could be important in avoiding gene silencing due to co-suppression, and if needed assist in the selection of lines suitable for future deregulation. The same primer pairs can be used to quantify many different wheat transgenic events because the construct-specific primer pairs are targeted to standard sequence elements of the cereal gene cassettes, making the method widely applicable in wheat GM research. Moreover, because all procedures described here are standardized, the method may easily be adapted to vectors lacking the target regions used here and/or to other plant models.

Fast-Tracking Determination of Homozygous Transgenic Lines and Transgene Stacking Using a Reliable Quantitative Real-Time PCR Assay

“…In addition, none of the qPCR-based method has been utilized for gene stacking to show the accuracy highly consistent among qPCR, genetic segregation, and Southern Blotting analysis [7][8][9]19]. Our results indicated that our protocol not only was more effective and accurate than previously published qPCR methods, but also offered the distinct advantages of relative simplicity, rapid screening, and comparable accuracy over traditional methods such as Southern Blotting and previously published qPCR methods.…”

Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development

“…New primers were developed for TaAmy3 following the procedures described in Mieog et al (2013); TaAmy3FP: TTCTTTTCCAGGGGTTTAATTGGG, TaAmy3RP: CTCCACCTTCCCTTGCATGA.…”

New insight in cereal starch degradation: identification and structural characterization of four α-amylases in bread wheat

“…DNA for copy number analyses was extracted and homeoform-specific primer pairs for TaAMY4, and isoformspecific primers (but not homeoform-specific) pairs for TaAMY1 and 2, were developed and tested as described in Mieog et al [25]. Plasmids containing clones for each homeoform of TaAMY4 as well as for Epsilon Cyclase genome A, obtained during sequencing procedures, were used to make a mixed plasmid sample, which was used as a calibrator sample for TaAMY4 homeoform copy number determinations.…”

“…Amylase-isoform specific primers for real-time quantitative PCR (RT-qPCR) were developed for TaAMY1, 2 and 4 as previously described for qPCR [25]. TaAMY3 primers as well as primers for a reference housekeeping gene (actin) were already available [17].…”