Fexofenadine Regulates Nuclear Factor-κB Signaling and Endoplasmic Reticulum Stress in Intestinal Epithelial Cells and Ameliorates Acute and Chronic Colitis in Mice

Abstract

The aim of this study was to evaluate the effect of fexofenadine on intestinal inflammation. HCT116 and COLO205 cells were pretreated with fexofenadine and then stimulated with tumor necrosis factor (TNF)-a. Interleukin (IL)-8 expression was determined by real-time reverse-transcription polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay. DNA-binding activity of nuclear factor-kB was assessed by electrophoretic mobility shift assay. The molecular markers of endoplasmic reticulum (ER) stress were evaluated by Western blot analysis and PCR. In the acute colitis model, mice were given 4% dextran sulfate sodium (DSS) for 5 days with or without fexofenadine. IL-10 2/2 mice were used to evaluate the effect of fexofenadine on chronic colitis. Fexofenadine significantly inhibited the upregulated expression of IL-8 in HCT116 and COLO205 cells stimulated with TNF-a. Fexofenadine suppressed nuclear factor-kB DNA-binding activity. C/EBP homologous protein mRNA expression was enhanced in the presence of TNF-a, and it was dampened by pretreatment of fexofenadine. In addition, the induction of ER stress markers caspase-12 and p-eukaryotic initiation factor 2 (eIF2)-a was significantly suppressed by the pretreatment of fexofenadine. Administration of fexofenadine significantly reduced the severity of DSS-induced murine colitis, as assessed by the disease activity index, colon length, and histology. In addition, the DSS-induced phospho-IkB kinase activation was significantly decreased in fexofenadinepretreated mice. Finally, fexofenadine significantly reduced the severity of colitis and the immunoreactivity of caspase-12 and p-eIF2-a in IL-10 2/2 mice as compared with controls. These results suggest that fexofenadine is a potential therapeutic agent for the treatment of inflammatory bowel disease.

Rosmarinus officinalis L. extract ameliorates intestinal inflammation through MAPKs/NF-κB signaling in a murine model of acute experimental colitis

“…2 It has been well established that inflammation plays a crucial role in the pathogenesis of ulcerative colitis. 1,4,5 Apart from this, the role of oxygen-derived free radicals and activated neutrophils releasing injurious molecules including reactive oxygen metabolites have also plays an imperative role as that triggers the intestinal inflammation and subsequent tissue injury. 1,4,5 Apart from this, the role of oxygen-derived free radicals and activated neutrophils releasing injurious molecules including reactive oxygen metabolites have also plays an imperative role as that triggers the intestinal inflammation and subsequent tissue injury.…”

Tauroursodeoxycholic acid attenuates colitis‐associated colon cancer by inhibiting nuclear factor kappaB signaling

“…Pretreated HCT 116 and COLO 205 cells were stimulated with TNF‐α (10 ng/mL) for 4 h. Interleukin (IL)‐8 and IL‐1α mRNA expression was measured by real time reverse transcription‐polymerase chain reaction (RT–PCR). In addition, RT–PCR analysis of expression of NF‐κB‐regulated anti‐apoptotic genes ( bcl‐xL , MCL1 , and cFLIP‐L ) and VEGF was performed in both HCT 116 and COLO 205 cells with or without TUDCA treatment (50 μg) for 20 h. Total cellular RNA was extracted from cells using Trizol (GIBCO, Gaithersburg, MD, USA) and 1 μg of the extracted RNA was reverse‐transcribed and subsequently amplified using LightCycler 480 DNA SYBR Green I Master (Roche Applied Science, Penzberg, Germany) and LightCycler 480 II (Roche Diagnostics Ltd., Rotkreuz, Switzerland) as described previously . The primer sequences were as follows: IL‐1α (S) 5′‐TCACGGCTGCTGCATTACAT‐3′, (AS) 5′‐GCCGTGAGTTTCCCAGAAGA‐3′; IL‐8 (S): 5′‐AAACCACCGGAAGGAACCAT‐3′, (AS) 5′‐CCTTCACACAGAGCTGCAGAAA‐3′; bcl‐xL (S): 5′‐CGGGCATTCAGTGACCTGAC‐3′, (AS): 5′‐TCAGGAACCAGCGGTTGAAG‐3′; MCL1 (S): 5′‐CGGTAATCGGACTCAACCTC‐3′, (AS): 5′‐CCTCCTTCTCCGTAGCCAA‐3′; cFLIP‐L (S): 5′‐AATTCAAGGCTCAGAAGCGA‐3′, (AS): 5′‐GGCAGAAACTCTGCTGTTCC‐3′; VEGF (S): 5′‐TTCCAGGAGTACCCTGATGAG‐3′, (AS): 5′‐GGCTCACCGCCTCGGCTTGTC‐3′; β‐actin (S): 5′‐CGGGGTCACCCACACTGTGCCCATCTA‐3′, (AS): 5′‐CTAGAAGCATTGCGGTGGACGATGGAGGG‐3′.…”

“…Pretreated HCT 116 cells were stimulated with TNF‐α (10 ng/mL) for 30 min. To detect changes in the DNA binding activity of NF‐κB, electrophoretic mobility shift assay (EMSA) analysis was performed using a commercial kit (Promega, Madison, WI, USA), as described previously …”

Oxidative stress-induced mitochondrial dysfunction in a normal colon epithelial cell line

“…Currently, there are many colon cancer cell lines including HCT116, SW620, and Caco-2 that are used to assess the oxidative damage induced dysfunction of epithelial cells in conditions like microbial gastro-enteritis, ulcerative colitis, and Crohn’s disease[8,9]. Many of these cell lines tend to underestimate or overestimate the cellular oxidative responses because of their inherent resistance to oxidative stress, changes in endogenous antioxidant levels, altered expression or activation of detoxifying systems, and altered susceptibility of mitochondria and genetic components to ROS attack[10,11].…”