First detection of zoonotic tapeworm Echinococcus granulosus sensu lato genotype G7 in continental Italy

Laurimäe, Teivi; Kinkar, Liina; Varcasia, Antonio; Dessì, Giorgia; Sgroi, Giovanni; D’Alessio, Nicola; Veneziano, Vincenzo; Saarma, Urmas

doi:10.1007/s00436-019-06346-2

Cited by 18 publications

(16 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Echinococcus canadensis G7 genotype was isolated from a goat specimen sampled from Beirut and is the first report on molecular identification of this genotype in Lebanon. Based on mitochondrial nad5 gene (680 bp) and nad2 gene (714 bp), it was identified that this sequence belonged to the G7b haplogroup of E. canadensis which was also recognized from other Mediterranean countries such as France and Italy (Laurimäe et al, 2019). A similar occurrence of pig strain in goats was reported earlier from Greece (Varcasia et al, 2007) and Iran (Fadakar et al, 2015) indicating that goats could harbour this genotype despite low levels of infection.…”

Section: Discussionsupporting

confidence: 72%

“…Twentynine isolates were further screened through nad5 mitochondrial gene employing the primers EGnd5F1 (GTTGTTGAAGTT GATTGTTTTGTTTG) and EGnd5R1 (GGAACACCGGACAA ACCAAGAA) for the correct identification of genotypes G1 and G3 (Kinkar et al, 2018b). A G7 isolate was also amplified using G7for (GTGTTGTGTTGTTGATAGATTG) and G7rev (GTAAAAATAATCACCACCCAAC) primers for nad2 gene (Laurimäe et al, 2019).…”

Section: Molecular Studiesmentioning

confidence: 99%

See 1 more Smart Citation

Cystic echinococcosis in sheep and goats of Lebanon

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Discussionsupporting

confidence: 72%

Section: Molecular Studiesmentioning

confidence: 99%

Cystic echinococcosis in sheep and goats of Lebanon

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…Genetic diversity based on haplotype diversity (Hd) and nucleotide diversity (π) as well as the number of polymorphic and parsimony-informative sites were measured using DnaSP v5.0 software. The sequences with accession numbers MK682655-56 and MK682657-58 [ 32 ] were used in the phylogenetic analysis as references for the G1 and G3 genotypes, respectively. The genotypes G5 (Acc.…”

Section: Methodsmentioning

confidence: 99%

Echinococcus granulosus sensu stricto G1 is the predominant genotype in human and livestock isolates from Turkey and Iran, based on mitochondrial nad5 gene differentiation

2021

View full text Add to dashboard Cite

Background Different genotypes of Echinococcus granulosus sensu stricto (s.s.) isolated from livestock and humans have been identified based on cox1 and nad1 genomic fragments. The present study was performed to differentiate the G1/G3 genotypes of Echinococcus granulosus (s.s.) isolated from humans and livestock (sheep and cattle) from Azerbaijan in northwestern Iran, Fars Province in southern Iran, and Van province in Eastern Turkey, using the nad5 gene fragment as a suitable marker to distinguish these two genotypes. Methods A total of 60 pathologically confirmed human hydatid cysts and 90 hydatid cyst samples from livestock were collected from Turkey and Iran. PCR was performed on all of the samples, targeting the nad5 gene. Based on PCR product quality, host type, and the geographical area where the samples were obtained, 36 of the samples were sequenced and were used in the phylogenetic analysis. Results Out of 36 evaluated samples, 26 (72.2%) samples belonged to G1, and 10 (27.8%) samples belonged to the G3 genotype. Out of 21 samples from Turkey, 16 (76.2%) were G1 and 5 (23.8%) were G3, while out of 15 samples from Iran, 10 (66.7%) were G1 and 5 (33.3%) were the G3 genotype. None of the samples isolated from humans in Iran or from sheep in Turkey were G3. Overall, between the two countries, 18.18% of E. granulosus isolates in cattle, 41.66% of isolates in sheep, and 23.07% of human samples were identified as G3, and the others as the G1 genotype. The G3 genotype was not detected in human samples from Iran or sheep samples from Turkey. Conclusion The findings of the study revealed that the G1 genotype of E. granulosus s.s. is the predominant genotype in humans and livestock, both in Turkey and Iran. The ratio of the E. granulosus s.s. G1 to G3 genotype was 3.2 in Turkey and 2 in Iran. The study also further confirmed that the nad5 gene properly differentiated the G1/G3 isolates of E. granulosus from both humans and livestock. Graphical Abstract

show abstract

“…has been described in Italy, even though, the wild boar was recently found to be a wild intermediate host of E. granulosus s.l. and Taenia hydatigena [12,35,48,58]. Moreover, differences occurring in taeniid biodiversity in wolves living in anthropic areas could be the result of a combined effect of a low occurrence of taeniids in wild prey and a lower frequency of wild prey in the diet of wolves in anthropic areas than in those living in natural landscapes.…”

Section: Toxocara Canismentioning

confidence: 99%

Taeniid cestodes in a wolf pack living in a highly anthropic hilly agro-ecosystem

et al. 2021

View full text Add to dashboard Cite

The Italian wolf population in human-modified landscapes has increased greatly in the last few decades. Anthropisation increases the risk of transmission of many zoonotic infections and in this context, control of taeniid cestode species needs to be addressed from a One Health perspective. Predator-prey interactions are at the root of taeniid cestode transmission, and the wolf plays a key role in the maintenance and transmission of taeniids. To date, all available data on the taeniids of wolves in Italy refer to populations living in a wild habitat. Between 2018 and 2019, we investigated taeniids in a wolf pack living in a highly anthropic hilly agro-ecosystem. Thirty-eight faecal samples were collected and analysed, 4 of which were also genetically characterised for individual wolves and belonged to three different animals. Samples collected were analysed microscopically and by molecular analysis in order to identify the taeniid species. Taeniid eggs were detected in 34.2% (13/38) of samples. Within samples positive to taeniid eggs only Echinococcus granulosus s.s. and Taenia hydatigena were identified in 26.3% and 10.5% of the samples, respectively. On microscopic examination, Capillaria spp., Ancylostomatidae and Toxocara canis eggs, Crenosoma vulpis larvae, and coccidian oocysts were also found. The combination of low biodiversity of taeniid species with a high occurrence of E. granulosus s.s. recorded in this study could be the consequence of a deeper link occurring between wolves and livestock in human-modified landscapes than in wild settings.

show abstract

First detection of zoonotic tapeworm Echinococcus granulosus sensu lato genotype G7 in continental Italy

Cited by 18 publications

References 56 publications

Cystic echinococcosis in sheep and goats of Lebanon

Cystic echinococcosis in sheep and goats of Lebanon

Echinococcus granulosus sensu stricto G1 is the predominant genotype in human and livestock isolates from Turkey and Iran, based on mitochondrial nad5 gene differentiation

Taeniid cestodes in a wolf pack living in a highly anthropic hilly agro-ecosystem

Contact Info

Product

Resources

About