FOXM1/lncRNA TYMSOS/miR-214-3p–Mediated High Expression of NCAPG Correlates With Poor Prognosis and Cell Proliferation in Non–Small Cell Lung Carcinoma

Yuan, Yixiao; Jiang, Xiulin; Tang, Lin; Wang, Juan; Zhang, Dahang; Cho, William C.; Duan, Lincan

doi:10.3389/fmolb.2021.785767

Cited by 17 publications

(21 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Emerging evidence has demonstrated that tumor mutational burden (TMB) and microsatellite instability (MSI) could be a potential biomarker for predicting the efficacy of immunotherapy for lung cancer ( 29 ). The above findings indicated that the IRRGs were related to tumor immune infiltration.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Identification and Validation of lncRNA-SNHG17 in Lung Adenocarcinoma: A Novel Prognostic and Diagnostic Indicator

Yuan

Pal

et al. 2022

Front. Oncol.

Self Cite

View full text Add to dashboard Cite

BackgroundLung cancer has the highest death rate among cancers globally. Accumulating evidence has indicated that cancer-related inflammation plays an important role in the initiation and progression of lung cancer. However, the prognosis, immunological role, and associated regulation axis of inflammatory response-related gene (IRRGs) in non-small-cell lung cancer (NSCLC) remains unclear.MethodsIn this study, we perform comprehensive bioinformatics analysis and constructed a prognostic inflammatory response-related gene (IRRGs) and related competing endogenous RNA (ceRNA) network. We also utilized the Pearson’s correlation analysis to determine the correlation between IRRGs expression and tumor mutational burden (TMB), microsatellite instability (MSI), tumor-immune infiltration, and the drug sensitivity in NSCLC. Growth curve and Transwell assay used to verify the function of SNHG17 on NSCLC progression.ResultsFirst, we found that IRRGs were significantly upregulated in lung cancer, and its high expression was correlated with poor prognosis; high expression of IRRGs was significantly correlated with the tumor stage and poor prognosis in lung cancer patients. Moreover, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment indicated that these IRRGs are mainly involved in the inflammatory and immune response-related signaling pathway in the progression of NSCLC. We utilized 10 prognostic-related genes to construct a prognostic IRRGs model that could predict the overall survival of lung adenocarcinoma (LUAD) patients possessing high specificity and accuracy. Our evidence demonstrated that IRRGs expression was significantly correlated with the TMB, MSI, immune-cell infiltration, and diverse cancer-related drug sensitivity. Finally, we identified the upstream regulatory axis of IRRGs in NSCLC, namely, lncRNA MIR503HG/SNHG17/miR-330-3p/regulatory axis. Finally, knockdown of SNHG17 expression inhibited lung adenocarcinoma (LUAD) cell proliferation and migration. Our findings confirmed that SNHG17 is a novel oncogenic lncRNA and may be a biomarker for the prognosis and diagnosis of LUAD.ConclusionDNA hypomethylation/lncRNA MIR503HG/SNHG17/microRNA-330-3p/regulatory axis may be a valuable biomarker for prognosis and is significantly correlated with immune cell infiltration in lung cancer.

show abstract

Section: Resultsmentioning

confidence: 99%

“…The quantitative real-time PCR (qRT-PCR) assay was performed as documented ( 29 ). The primer sequences are list follows: SNHG17-F, GATTGTCAGCTGACCTCTGTC; SNHG17-R, GTGGTAGCCTCACTCTCCATTCTCTGCCCCT; β-actin-F, CTTCGCGGGCGACGAT; and β-actin-R, CCATAGGAATCCTTCTGACC.…”

Section: Methodsmentioning

confidence: 99%

Identification and Validation of lncRNA-SNHG17 in Lung Adenocarcinoma: A Novel Prognostic and Diagnostic Indicator

Yuan

Pal

et al. 2022

Front. Oncol.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Cell migration and invasion assay was performed as previously documented ( 20 ). For transwell assay, 2.5×10 4 cells in 100 μl of serum-free medium were plated in a 24-well plate chamber insert, with medium containing 10% FBS at the bottom of the insert.…”

Section: Methodsmentioning

confidence: 99%

Extra Spindle Pole Bodies-Like 1 Serves as a Prognostic Biomarker and Promotes Lung Adenocarcinoma Metastasis

Nie

Han

et al. 2022

Front. Oncol.

Self Cite

View full text Add to dashboard Cite

Extra spindle pole bodies-like 1 (ESPL1), a cysteine endopeptidase, plays a vital role in chromosome inheritance. However, the association of ESPL1 with prognosis and immune infiltration in lung adenocarcinoma (LUAD) has not yet been explored. Here, we analyzed the expression level, prognostic values, diagnostic value, and immune infiltration level in LUAD using various databases. Immunohistochemistry (IHC) and quantitative real-time PCR (qRT-PCR) assays were used to detect the expression of ESPL1 in LUAD tissues and cell lines. In this study, we found that ESPL1 was upregulated in LUAD and a higher expression of ESPL1 was correlated with unfavorable prognosis in LUAD. Meanwhile, Cox hazard regression analysis results suggested that ESPL1 may be an independent prognostic factor for LUAD. Moreover, we demonstrated that ESPL1 expression was significantly correlated with immune infiltration of Th2 and dendritic cells in LUAD. We also confirmed that DNA copy number amplification and DNA hypo-methylation were positively correlated with ESPL1 expression in LUAD. Additionally, DNA copy number amplification was significantly associated with adverse clinical outcomes in LUAD. Kyoto Encyclopedia of Genes and Genomes (KEGG) and gene set enrichment analysis (GSEA) confirmed that ESPL1 was mainly involved in the DNA replication and glycolysis signaling pathway. Finally, we revealed that ESPL1 was highly expressed in LUAD tissues and cell lines. Knockdown of ESPL1 significantly inhibited cell migration and the invasion abilities of LUAD. Our study comprehensively confirmed that ESPL1 expression may serve as a novel prognostic biomarker for both the clinical outcome and immune cell infiltration in LUAD.

show abstract

“…The qRT-PCR assay was performed as documented ( 29 ). The primer sequences are list follows: miR-195-5p-F: GAATTCGCCTCAAGAGAACAAAGTGGAG, miR-195-5p R: AGATCTCCCATGGGGGCTCAGCCCCT; U6-F: GGTCGGGCAGGAAAGAGGGC, U6-R: GCTAATCTTCTCTGTATCGTTCC, PTBP1-F: AGCGCGTGAAGATCCTGTTC, PTBP1-R: CAGGGGTGAGTTGCCGTAG, β-actin-F: CTTCGCGGGCGACGAT, β-actin-R: CCATAGGAATCCTTCTGACC.…”

Section: Methodsmentioning

confidence: 99%

Immune-Related miRNA-195-5p Inhibits the Progression of Lung Adenocarcinoma by Targeting Polypyrimidine Tract-Binding Protein 1

et al. 2022

Self Cite

View full text Add to dashboard Cite

PurposeLung adenocarcinoma (LUAD) is the most common type of cancer and the leading cause of cancer-related death worldwide, resulting in a huge economic and social burden. MiRNA-195-5p plays crucial roles in the initiation and progression of cancer. However, the significance of the miRNA-195-5p/polypyrimidine tract-binding protein 1 (miRNA-195-5p/PTBP1) axis in the progression of lung adenocarcinoma (LUAD) remains unclear.MethodsData were collected from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. The starBase database was employed to examine the expression of miRNA-195-5p, while the Kaplan–Meier plotter, UALCAN, and Gene Expression Profiling Interactive Analysis (GEPIA) databases were utilized to analyze the tumor stage and prognostic value of miRNA and PTBP1. Quantitative reverse transcription-polymerase chain reaction assay was conducted to detect the expression levels of miRNA-195-5p in LUAD cell lines and tissues. The effects of miRNA-195-5p on cell proliferation and migration were examined using the cell growth curve, clone information, transwell assays, and wound healing assays.ResultsWe found that miRNA-195-5p was down-regulated in LUAD cancer and cell lines. Importantly, its low levels were related to the tumor stage, lymph node metastasis, and poor prognosis in LUAD. Overexpression of miR-195-5p significantly inhibited cell growth and migration promotes cell apoptosis. Further study revealed that PTBP1 is a target gene of miRNA-195-5p, and overexpression of miRNA-195-5p inhibited the progression of LUAD by inhibiting PTBP1 expression. MiRNA-195-5p expression was related to immune infiltration in lung adenocarcinoma. Moreover, PTBP1 was negatively correlated with diverse immune cell infiltration and drug sensitivity.ConclusionOur findings uncover a pivotal mechanism that miRNA-195-5p by modulate PTBP1 expression to inhibit the progression of LUAD. MiRNA-195-5p could be a novel diagnostic and prognostic molecular marker for LUAD.

show abstract

FOXM1/lncRNA TYMSOS/miR-214-3p–Mediated High Expression of NCAPG Correlates With Poor Prognosis and Cell Proliferation in Non–Small Cell Lung Carcinoma

Cited by 17 publications

References 66 publications

Identification and Validation of lncRNA-SNHG17 in Lung Adenocarcinoma: A Novel Prognostic and Diagnostic Indicator

Identification and Validation of lncRNA-SNHG17 in Lung Adenocarcinoma: A Novel Prognostic and Diagnostic Indicator

Extra Spindle Pole Bodies-Like 1 Serves as a Prognostic Biomarker and Promotes Lung Adenocarcinoma Metastasis

Immune-Related miRNA-195-5p Inhibits the Progression of Lung Adenocarcinoma by Targeting Polypyrimidine Tract-Binding Protein 1

Contact Info

Product

Resources

About