Functional dichotomy of ribosomal proteins during the synthesis of mammalian 40S ribosomal subunits

O’Donohue, Marie-Françoise; Choesmel, Valérie; Faubladier, Marlène; Fichant, Gwennaële; Gleizes, Pierre‐Emmanuel

doi:10.1083/jcb.201005117

Cited by 184 publications

(252 citation statements)

References 76 publications

Supporting

Mentioning

223

Contrasting

Unclassified

Order By: Relevance

“…However, p53 mutation could not rescue the embryonic lethality of rps29 mutants. The inability to rescue embryonic lethality is likely because once maternal rps29 is completely lost, embryos can no longer make new ribosomes, as has been demonstrated in mammalian cell culture[19]. Even if p53 is also removed, the embryos still cannot make new proteins and therefore will die without rps29.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Hematopoietic defects in rps29 mutant zebrafish depend upon p53 activation

Taylor

Humphries

White

et al. 2012

Experimental Hematology

View full text Add to dashboard Cite

Disruption of ribosomal proteins is associated with hematopoietic phenotypes in cell culture and animal models. Mutations in ribosomal proteins are seen in patients with Diamond Blackfan anemia (DBA), a rare congenital disease characterized by red cell aplasia and distinctive craniofacial anomalies. A zebrafish screen uncovered decreased hematopoietic stem cells (HSCs) in embryos with mutations in ribosomal protein rps29. Here, we determined that rps29-/- embryos also have red blood cell defects and increased apoptosis in the head. As the p53 pathway has been shown to play a role in other ribosomal protein mutants, we studied the genetic relationship of rps29 and p53. Transcriptional profiling revealed that genes up-regulated in the rps29 mutant are enriched for genes up-regulated by p53 after irradiation. p53 mutation near completely rescues the rps29 morphological and hematopoietic phenotypes, demonstrating that p53 mediates the effects of rps29 knockdown. We also identified neuronal gene orthopedia protein a (otpa) as one whose expression correlates with rps29 expression, suggesting that levels of expression of some genes are dependent on rps29 levels. Together, our studies demonstrate a role of p53 in mediating the cellular defects associated with rps29 and establish a role for rps29 and p53 in HSCs and red blood cell development.

show abstract

Section: Resultsmentioning

confidence: 99%

“…Rps29, a protein in the 40s small subunit of the ribosome important for rRNA processing and ribosome biogenesis[19], was found to be required for definitive hematopoiesis in the zebrafish embryo[20]. The rps29 mutant has decreased HSC markers runx and myb at 36 hours post fertilization (hpf) in the aorta gonad mesonephros (AGM) region.…”

Section: Introductionmentioning

confidence: 99%

Hematopoietic defects in rps29 mutant zebrafish depend upon p53 activation

Taylor

Humphries

White

et al. 2012

Experimental Hematology

View full text Add to dashboard Cite

show abstract

“…62 Conjugated FISH probes were purchased from Eurogentec: its1-Cy5: tagacacggaagagccggacgggaaaga; its2-Cy3: gcgattgatcgtcaaccgacgctc; 28S-Alexa488: cccgttcccttggctgtggtttcgctggata; 18S-Cy5: tttacttcctctagatagtcaagttc gacc and validated in a previous study. 23 Crypts culture.…”

Section: Discussionmentioning

confidence: 99%

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

et al. 2015

View full text Add to dashboard Cite

International audienceRibosome biogenesis is an essential cellular process. Its impairment is associated with developmental defects and increased risk of cancer. The in vivo cellular responses to defective ribosome biogenesis and the underlying molecular mechanisms are still incompletely understood. In particular, the consequences of impaired ribosome biogenesis within the intestinal epithelium in mammals have not been investigated so far. Here we adopted a genetic approach to investigate the role of Notchless (NLE), an essential actor of ribosome biogenesis, in the adult mouse intestinal lineage. Nle deficiency led to defects in the synthesis of large ribosomal subunit in crypts cells and resulted in the rapid elimination of intestinal stem cells and progenitors through distinct types of cellular responses, including apoptosis, cell cycle arrest and biased differentiation toward the goblet cell lineage. Similar observations were made using the rRNA transcription inhibitor CX-5461 on intestinal organoids culture. Importantly, we found that p53 activation was responsible for most of the cellular responses observed, including differentiation toward the goblet cell lineage. Moreover, we identify the goblet cell-specific marker Muc2 as a direct transcriptional target of p53. Nle-deficient ISCs and progenitors disappearance persisted in the absence of p53, underlying the existence of p53-independent cellular responses following defective ribosome biogenesis. Our data indicate that NLE is a crucial factor for intestinal homeostasis and provide new insights into how perturbations of ribosome biogenesis impact on cell fate decisions within the intestinal epithelium

show abstract

“…RP depletions in yeast and siRNA-mediated knockdowns in cultured mammalian cells showed that most RPs are essential for ribosome biogenesis (Ferreira-Cerca et al 2005;Robledo et al 2008;Poll et al 2009;Babiano and de la Cruz 2010;O'Donohue et al 2010;Jakovljevic et al 2012;Gamalinda et al 2013). However, phenotypic analyses of these mutants were primarily limited to assaying effects on pre-rRNA processing and nucleocytoplasmic export of preribosomes.…”

mentioning

confidence: 99%

“…To our knowledge, no global picture of the hierarchy of 60S subunit assembly from the beginning to the end has been described thus far. We reasoned that the correlation between the location and function of RPLs might reflect sequential construction of stable pre-60S assembly intermediates, analogous to the biogenesis of small ribosomal subunits (Held et al 1974;Ferreira-Cerca et al 2007;Mulder et al 2010;O'Donohue et al 2010).…”

mentioning

confidence: 99%

A hierarchical model for assembly of eukaryotic 60S ribosomal subunit domains

et al. 2014

View full text Add to dashboard Cite

Despite having high-resolution structures for eukaryotic large ribosomal subunits, it remained unclear how these ribonucleoprotein complexes are constructed in living cells. Nevertheless, knowing where ribosomal proteins interact with ribosomal RNA (rRNA) provides a strategic platform to investigate the connection between spatial and temporal aspects of 60S subunit biogenesis. We previously found that the function of individual yeast large subunit ribosomal proteins (RPLs) in precursor rRNA (pre-rRNA) processing correlates with their location in the structure of mature 60S subunits. This observation suggested that there is an order by which 60S subunits are formed. To test this model, we used proteomic approaches to assay changes in the levels of ribosomal proteins and assembly factors in preribosomes when RPLs functioning in early, middle, and late steps of pre-60S assembly are depleted. Our results demonstrate that structural domains of eukaryotic 60S ribosomal subunits are formed in a hierarchical fashion. Assembly begins at the convex solvent side, followed by the polypeptide exit tunnel, the intersubunit side, and finally the central protuberance. This model provides an initial paradigm for the sequential assembly of eukaryotic 60S subunits. Our results reveal striking differences and similarities between assembly of bacterial and eukaryotic large ribosomal subunits, providing insights into how these RNA-protein particles evolved.

show abstract

Functional dichotomy of ribosomal proteins during the synthesis of mammalian 40S ribosomal subunits

Abstract: Subsets of 40S ribosomal subunits are required for initiating rRNA processing, rRNA maturation, and nuclear export.

Cited by 184 publications

References 76 publications

Hematopoietic defects in rps29 mutant zebrafish depend upon p53 activation

Hematopoietic defects in rps29 mutant zebrafish depend upon p53 activation

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

A hierarchical model for assembly of eukaryotic 60S ribosomal subunit domains

Contact Info

Product

Resources

About