Future Directions in the Treatment of IgA Nephropathy

Abstract

IgA nephropathy (IgAN) is the most common primary glomerulonephritis yet its etiology remains uncertain. Recent data suggest a structural aberration of the IgA molecule in IgAN that may exert pathophysiologic effects on target cells, reduce clearance of IgA-immune complexes (IC), or favor mesangial IC trapping. Mesangial reactivity to immune complexes triggers off the release of cytokines and the alteration of prostaglandin and thromboxane A₂ production promoting mesangial cell proliferation. Angiotensin II-induced mesangial cells contraction with efferent arteriolar vasodilatation initiates glomerular injury and eventually lead to glomerulosclerosis following increased local production of transforming growth factor-β (TGF-β) and platelet-derived growth factor (PDGF). This paper highlights the potential therapeutic strategies in the future. These strategies include: (i) decreasing the synthesis of IgA-IC; (ii) limiting the mesangial uptake of IgA-IC; (iii) antagonizing the effect of PDGF and TGF-β to reduce mesangial proliferation and glomerulosclerosis; and (iv) reducing the noxious glomerular injury due to infiltrating neutrophils. The effective treatment of IgAN requires a better clarification of the pathogenesis of the nephropathy. Future therapeutic attempts to slow down the renal deterioration should target at prevention of mesangial IgA deposition and the amelioration of inflammatory injury induced by infiltrating neutrophils and the released cytokines.

Low α-defensin gene copy number increases the risk for IgA nephropathy and renal dysfunction

“…The PCR for the Del4 assay was performed by using1uM of the primers TGCTCTCATTTTTGCATTCC and NED-TTTCTCCAAAGACTTGATTCCAA and 27 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 68°C for 60 seconds, followed by a 70°C hold for 40 minutes to generate amplicon 18 products of 211bp/215bp from 10ng genomic DNA input. The products were mixed with 10ul…”

“…Although CNVs have been suggested to play important roles in disease development (10,12,13), the associations of CNVs, particularly the role complex multi-allelic CNVs may play in complex diseases, are poorly studied and understood, mainly due to experimental difficulties in measuring the copy number of such variants accurately (14).The -defensin locus (DEFA1A3) is one of the complex multi-allelic CNVs, presents as tandem repeats of a 19kb sequence unit, each of which contains one copy of DEFA1 or DEFA3(differing by a single non-synonymous coding variant within the third exon) as well as several internal bi-allelic polymorphisms (15)(16)(17). The protein products of DEFA1A3, HNP1-3 (human neutrophil peptide 1to 3), are the most abundant of neutrophil granule proteins, and there is evidence to suggest that neutrophils may play an important role in mediating glomerular injury in IgAN (18)(19)(20). HNP1-3 have also been suggested to play a role in the regulation of the complement system and pro-inflammatory cytokine production both of which have been shown to play important pathogenic roles in IgAN (21)(22)(23).…”

Modulating the Progression in IgA Nephropathy

“…In Japan, tonsillectomy is widely used in patients with IgA nephropathy, based on the assumption that tonsillectomy changes mucosal immunity to prevent uncharacterized antigenic deposition in the kidneys [81]. However, its applicability has not been accepted in other parts of the world.…”

Immunoglobulin A1 protease: A new therapeutic candidate for immunoglobulin A nephropathy

“…Although conventional drugs such as antihypertensive drugs, corticosteroids and immunodepressants could stabilize renal function, long‐term uses of these drugs carry severe toxicities and other risks. At present, many therapies of IgAN focus on symptomatic treatment strategies mostly directed at downstream immune and inflammatory events, for example, precise control of hypertension, amelioration of proteinuria and attenuation of renal injury, but fewer attempts to remove mesangial deposited IgA1, the cardinal features of the IgAN 8 . Hence, it is reasonable to develop new therapeutic strategies to remove deposited IgA1 at the early stage.…”