G-quadruplex-induced instability during leading-strand replication

Abstract

G-quadruplexes are four-stranded nucleic acid structures whose biological functions remain poorly understood. In the yeast S. cerevisiae, we report that G-quadruplexes form and, if not properly processed, pose a specific challenge to replication. We show that the G-quadruplex-prone CEB1 tandem array is tolerated when inserted near ARS305 replication origin in wild-type cells but is very frequently destabilized upon treatment with the potent Phen-DC 3 G-quadruplex ligand, or in the absence of the G-quadruplexunwinding Pif1 helicase, only when the G-rich strand is the template of leading-strand replication. The orientationdependent instability is associated with the formation of Rad51-Rad52-dependent X-shaped intermediates during replication detected by two-dimensional (2D) gels, and relies on the presence of intact G-quadruplex motifs in CEB1 and on the activity of ARS305. The asymmetrical behaviour of G-quadruplex prone sequences during replication has implications for their evolutionary dynamics within genomes, including the maintenance of G-rich telomeres.

A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites

“…Whether these structures pose a block to lagging strand synthesis 16 or leading strand synthesis, as was suggested by data derived in yeast 13 , is unknown, and there are no indications in our experiments hinting towards one or the other. We can nevertheless rule out a requirement for ongoing transcription across a G4 locus for it to become mutagenic, as was recently shown to be the case for G4-induced antigenic variation in N. gonorrhoeae 30 : some of the G4-containing loci we studied, including the one in unc-22, are not transcribed in germ cells 31 ; still they give rise to inheritable genome alterations.…”

“…This human pathogen evades its host's immune system by changing the identity of its surface antigen via a G4 DNAinduced recombination event 10 . Importantly, however, this example also illustrates the recombinogenic and thus potentially pathological nature of this highly thermal stable non-B-DNA structure-a concern further fuelled by the notion of hampered DNA replication near G4 sequences in yeast [11][12][13] and the observed association of G4 motifs with structural genomic variations in human cancers 14 .…”

The Escherichia coli Tus–Ter replication fork barrier causes site-specific DNA replication perturbation in yeast

“…Two genomic locations were used in this study. The Chromosome III location was based on a previous study by Lopes et al 48 , and the TerB modules were inserted between two non-essential ORFs (YCL049C and YCL048W), located B2 kb to the right of ARS305. The following 65-bp primer sequences were used as PCR-product overhangs to target TerB modules into the Chromosome III location: 5 0 -GAGCAAGACAAACAGGGCCAGCTGATGCATA TGTTTTGTGTTGCTTTCCTACGATCAGCTAATGC-3 0 , and 5 0 -GGAAAATG AGTTTTGTCCCACCTTCCCTTTGGGAAAAGGCAATGTAAATCTTAGAGGC AAGAACC-3 0 .…”

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase

“…The most likely candidate for the role of G4 resolution in mitochondria is PIF1 helicase. Studies from the Nicolas and Zakian laboratories have implicated yeast PIF in G4 metabolism (21,22,(62)(63)(64)(65)(66). Although the recombinant nuclear form of human Pif1 has been shown to unwind G4 DNA substrates in vitro (67), a definitive role for human PIF1 in mitochondrial G4 metabolism remains to be determined.…”