Gene expression during development of Myxococcus xanthus

Downard, J S; Kupfer, Doris M.; Zusman, David R.

doi:10.1016/0022-2836(84)90180-3

Journal of Molecular Biology

1984

DOI: 10.1016/0022-2836(84)90180-3

|View full text |Cite

Gene expression during development of Myxococcus xanthus

J S Downard

Doris M. Kupfer

David R. Zusman

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...

Citation Types

Supporting

Mentioning

Contrasting

Year Published

1985

2002

Publication Types

Select...

Article8

Relationship

Self Cite0

Independent8

Authors

Journals

Cited by 40 publications

(46 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We examined the half-life of MBHA mRNA by hybridization of32P-labeled mbhA DNA with RNA extracted at various times after the treatment of developmental cells with rifampicin. The results showed that the MBHA mRNA was extremely stable, having a half-life of over 30 min (J.M.R., D. R. Nelson, and D.R.Z., unpublished results); the appearance of such stable mRNAs during development in M. xanthus has been noted previously (6,26,27).…”

mentioning

confidence: 69%

Nucleotide sequence of the myxobacterial hemagglutinin gene contains four homologous domains.

Romeo¹,

Esmon²,

Zusman³

1986

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Myxococcus xanthus, a Gram-negative bacterium, has a complex life cycle that includes fruiting-body formation, a primitive form of multicellular development. Myxobacterial hemagglutinin (MBHA) is a lectin that is induced during the aggregation phase of fruiting-body formation. We have cloned the gene for MBHA and determined its sequence by the dideoxy chain-termination technique. The sequence data show the probable sites for translational initiation and termination and suggest that MBHA does not contain a cleaved leader signal peptide. The DNA sequence shows four strong internal homologies. The deduced amino acid sequence shows that the protein (Mr 27,920) consists of four highly conserved domains each consisting of 67 amino acids. Thus MBHA is physically multivalent in structure, a requirement for all hemagglutinins.

show abstract

mentioning

confidence: 69%

Nucleotide sequence of the myxobacterial hemagglutinin gene contains four homologous domains.

Romeo¹,

Esmon²,

Zusman³

1986

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Upon nutrient starvation at a high cell density on a solid surface, cells move by gliding into aggregation centers, where they form mounds consisting of approximately 10 5 cells. Within the mounds, the motile, rod-shaped cells differentiate into nonmotile, spherical myxospores.…”

mentioning

confidence: 99%

“…The tps gene is expressed at low levels during vegetative growth, and its expression is highly induced at 5 h poststarvation (7,10,13). Developmentally regulated tps expression is absolutely dependent on the A and E signals and FruA, partially dependent on the B and D signals, and independent of the C signal (6,11,17,28,30,32).…”

mentioning

confidence: 99%

Analysis of dofA , a fruA -Dependent Developmental Gene, and Its Homologue, dofB , in Myxococcus xanthus

et al. 2002

View full text Add to dashboard Cite

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGC CG, in developmentally regulated dofA expression is suggested.

show abstract

“…In this report we have identified a new, abundant spore surface protein of M. xanthus. Protein C has previously been observed in papers describing protein S but has not been characterized (3,11). The significance of protein C on the spore surface has probably been overlooked because it was present in variable amounts from experiment to experiment.…”

mentioning

confidence: 99%

“…We do not yet know the function of protein C or protein S. Mutants lacking both Tps and Ops are viable and do not display significant defects in aggregation, fruiting body formation, or heat and sonication resistance of spores (3,7,14). It is possible that protein C has a function similar to that of protein S and that an easily discernible phenotype was not observed in the ops tps double mutant because of functional redundancy with protein C. It is also possible that protein C is involved in other functions, such as spore cohesion, resistance to UV light, or germination.…”

mentioning

confidence: 99%

Myxococcus xanthus protein C is a major spore surface protein

1991

View full text Add to dashboard Cite

Fruiting body formation in Myxococcus xanthus involves the aggregation of cells to form mounds and the differentiation of rod-shaped cells into spherical myxospores. The surface of the myxospore is composed of several sodium dodecyl sulfate (SDS)-soluble proteins, the best characterized of which is protein S (Mr, 19,000). We have identified a new major spore surface protein called protein C (Mr, 30,000). Protein C is not present in extracts of vegetative cells but appears in extracts of developing cells by 6 h. Protein C, like protein S, is produced during starvation in liquid medium but is not made during glycerol-induced sporulation. Its synthesis is blocked in certain developmental mutants but not others. When examined by SDS-polyacrylamide gel electrophoresis, two forms of protein C are observed. Protein C is quantitatively released from spores by treatment with 0.1 N NaOH or by boiling in 1% SDS. It is slowly washed from the spore surface in water but is stabilized by the presence of magnesium. Protein C binds to the surface of spores depleted of protein C and protein S. Protein C is a useful new marker for development in M. xanthus because it is developmentally regulated, spore associated, abundant, and easily purified.

show abstract

scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.

Contact Info

customersupport@researchsolutions.com

10624 S. Eastern Ave., Ste. A-614

Henderson, NV 89052, USA

This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

Blog Terms and Conditions API Terms Privacy Policy Contact Cookie Preferences Do Not Sell or Share My Personal Information

Made with 💙 for researchers

Part of the Research Solutions Family.

Gene expression during development of Myxococcus xanthus

Cited by 40 publications

References 28 publications

Nucleotide sequence of the myxobacterial hemagglutinin gene contains four homologous domains.

Nucleotide sequence of the myxobacterial hemagglutinin gene contains four homologous domains.

Analysis of dofA , a fruA -Dependent Developmental Gene, and Its Homologue, dofB , in Myxococcus xanthus

Myxococcus xanthus protein C is a major spore surface protein

Contact Info

Product

Resources

About