Generation of transgenic animals expressing the α and β chains of the autoreactive T-cell receptor

Zvezdova, Ekaterina; Silaeva, Yulia Yu.; Vagida, Murad; Maryukhnich, Elena; Deikin, A. V.; Ermolkevich, T. G.; Kadulin, S. G.; Садчикова, Е.Р.; Gol'dman, I. L.; Kazansky, Dmitry

doi:10.1134/s0026893310020135

Cited by 13 publications

(9 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The animals and the conditions of their care have been described previously (Silaeva et al 2013). Protocols for the induction of superovulation, obtaining fertilized eggs at the pronucleus stage in mice, microinjection, transplantation of eggs into the oviduct of the pseudopregnant recipient, and for preparing vasectomized males and recipient animals have been published previously (Silaeva et al 2013, Silaeva et al 2018, Zvezdova et al 2010.…”

Section: Methodsmentioning

confidence: 99%

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Kalmykov¹,

Kusov²,

Yablonskaia³

et al. 2018

RRP

View full text Add to dashboard Cite

Citation: Kalmykov VA, Kusov PA, Yablonskaia MI, Korshunov EN, Korshunova DS, Kubekina MV, Silaeva YYu, Deykin AV, Lukyanov NE (2018) New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy. AbstractIntroduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study:Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCG-GTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results:A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRIS-PR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F 2 have already been received from this mating. Discussion:During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion:In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

show abstract

Section: Methodsmentioning

confidence: 99%

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Kalmykov¹,

Kusov²,

Yablonskaia³

et al. 2018

RRP

View full text Add to dashboard Cite

show abstract

“…To generate primary transgenic animals, we used (CBAxC57BL/6)F1 zygotes obtained from 3 wk of age CBA and C57BL/6 breeders (Stolbovaya breeding station, Russian Federation). The transgene DNA construction was introduced by pronuclear microinjections as described earlier 49 . Surviving zygotes were cultivated in M16 medium, 37° C, 6% CO 2 for 24 h and then transplanted to oviducts of foster mothers at the 2-cells stage as previously described 50 .…”

Section: Animals Pronuclear Microinjections and Embryo Transfermentioning

confidence: 99%

Novel transgenic mice with Cre-dependent co-expression of GFP and human ACE2: a safe tool for study of COVID-19 pathogenesis

Bruter

Korshunova

Kubekina

et al. 2021

Preprint

View full text Add to dashboard Cite

Current coronavirus disease (COVID-19) pandemia still belongs to the most serious problems of public health. A growing body of data shows that infection caused by severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is a very complex and multifaceted disease requiring its detailed study to fight with. Nevertheless, there is a row of stumbling blocks in the way of experimental research of COVID-19 determined by the deficiency of appropriate animal models. Herein, we report novel humanized mice with Cre-dependent expression of hACE2, the main entry receptor of SARS-CoV-2. These mice carry hACE2 and GFP transgenes floxed by the STOP-cassette, allowing them to be used as breeders for the creation of animals with the tissue-specific co-expression of hACE2 and GFP. Moreover, inducible expression of hACE2 makes this line biosafe, whereas co-expression with GFP simplifies the detection of transgene-expressing cells. In our study, we tested our line by crossing with Ubi-Cre mice, characterized by tamoxifen-dependent ubiquitous activation of Cre-recombinase. After tamoxifen administration, copy number of the STOP-cassette was decreased and the offspring expressed hACE2 and GFP, confirming the efficiency of our system. We believe that our model can be a useful tool for studying COVID-19 pathogenesis because the selective expression of hACE2 can shed light on the role of different tissues in SARS-CoV-2 associated complications. Obviously, it can also be used for preclinical trials of antiviral drugs and new vaccines.

show abstract

“…To obtain primary transgenic animals, DNA (5 ng/mL in 0.1 mmol/L EDTA and 10 mmol/L Tris (pH 7.4)) was injected into the male pronuclei of F1 fertilized ova of (CBA × C57BL/6) mice, and the surviving microinjected zygotes were implanted into pseudopregnant recipients. The ova were obtained by inducing superovulation (Zvezdova et al 2010).…”

Section: Constructs Used In This Study and Obtaining Transgenic Animalsmentioning

confidence: 99%

The development of modified human Hsp70 (HSPA1A) and its production in the milk of transgenic mice

Gurskiy

Гарбуз

Сошникова

et al. 2016

Cell Stress and Chaperones

View full text Add to dashboard Cite

The production of major human heat shock protein Hsp70 (HSPA1A) in a eukaryotic expression system is needed for testing and possible medical applications. In this study, transgenic mice were produced containing wild-type human Hsp70 allele in the vector providing expression in the milk. The results indicated that human Hsp70 was readily expressed in the transgenic animals but did not apparently preserve its intact structure and, hence, it was not possible to purify the protein using conventional isolation techniques. It was suggested that the protein underwent glycosylation in the process of expression, and this quite common modification for proteins expressed in the milk complicated its isolation. To check this possibility, we mutated all presumptive sites of glycosylation and tested the properties of the resulting modified Hsp70 expressed in E. coli. The investigation demonstrated that the modified protein exhibited all beneficial properties of the wild-type Hsp70 and was even superior to the latter for a few parameters. Based on these results, a transgenic mouse strain was obtained which expressed the modified Hsp70 in milk and which was easy to isolate using ATP columns. Therefore, the developed construct can be explored in various bioreactors for reliable manufacture of high quality, uniform, and reproducible human Hsp70 for possible medical applications including neurodegenerative diseases and cancer.

show abstract

Generation of transgenic animals expressing the α and β chains of the autoreactive T-cell receptor

Cited by 13 publications

References 25 publications

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Novel transgenic mice with Cre-dependent co-expression of GFP and human ACE2: a safe tool for study of COVID-19 pathogenesis

The development of modified human Hsp70 (HSPA1A) and its production in the milk of transgenic mice

Contact Info

Product

Resources

About