Genes involved in carotene synthesis and mating in Blakeslea trispora

Abstract

Mating of Blakeslea trispora and other molds of the order Mucorales requires the interaction of mycelia of opposite sex, (+) and (¡), leading to the development of specialized structures and to an enhanced accumulation of -carotene. Industry obtains -carotene by co-cultivating appropriate strains of Blakeslea ("mated cultures"). Gene transcription in single and mated cultures was assayed by cDNA-AFLP, a technique to observe the diVerential expression of subsets of mRNA fragments. Overexpression in mated cultures is about ten times more frequent than underexpression. We obtained and sequenced fragments of 97 candidate genes that appeared to be overexpressed during mating and conWrmed four of them by reverse transcription and real-time PCR. Comparisons with gene sequences from other organisms suggest functions in carotene biosynthesis (4 genes), energy metabolism (8), cell wall synthesis (1), transfer of acetyl groups (1), and regulatory processes (10). Sodium acetate inhibited sexual overexpression in about two-thirds of the candidate genes and acted as a signal with broad eVects on the metabolism and the morphology of mated cultures. Our work oVers new materials for the study of carotene biosynthesis and its regulation and for the improvement of carotene production with Mucorales.

Cleavage oxygenases for the biosynthesis of trisporoids and other apocarotenoids in Phycomyces

“…Total RNA isolation, design of the primers (5′‐CCCGTCCTCAACTTCGACAA‐3′ and 5′‐GAGTAAAACGGCACACTTGAGAAGA‐3′ for gene 58172 ; 5′‐GCGGCTTGTGTCGAAGAAG‐3′ and 5′‐AGCATATTAGCATCTGTTTTGGTAACA‐3′ for 64508 ; 5′‐CGTTCTTTGCTGGACGATCA‐3′ and 5′‐CCGTGCTTGGAGGAAAAGG‐3′ for 76627 ; 5′‐CGCCAACCCAGCTTTGG‐3′ and 5′‐GCCTCACCTGTTCCGTTCTC‐3′ for acaA ; 5′‐CTTAGACGTTATCGCCTTGGAAA‐3′ and 5′‐GCGACCAGCGCGAAGT‐3′ for carS ; 5′‐TGGTTCCCATCGGTCACAT‐3′ and 5′‐GCACGCTTGACAATCATGGT‐3′ for carB ; 5′‐AGGCTGTCCTTTCCCTTTACG‐3′ and 5′‐GACACCATCACCGGAATCG‐3′ for act‐1 ), reverse transcription and real‐time PCR were performed as described (Winer et al ., 1999; Kuzina et al ., 2008), using the reagents in the TaqMan kit and the Power SYBR Green PCR Master Mix (Applied Biosystems).…”

Carotenoids

“…As observed in P. blakesleeanus , the induction is accompanied by higher carRA and carB mRNA [ 104 ] and enzyme levels [ 38 ], and affects the expression of many other genes involved in different physiological processes [ 105 ]. Under laboratory conditions, β-carotene production yields are improved using appropriate mutant strains, and similar results are obtained with either mated cultures or sexual heterokaryons [ 42 ].…”

Diversity, ecology, and evolution in Phycomyces

“…Sexual development is accompanied by modified levels of the transcripts of several hundred genes in mated cultures (Kuzina et al 2008).…”