Genetic analysis of colon tumors induced by a dietary carcinogen PhIP in CYP1A humanized mice: Identification of mutation of β‐catenin/Ctnnb1 as the driver gene for the carcinogenesis

Abstract

Replacing mouse Cyp1a with human CYP1A enables the humanized CYP1A mice to mimics human metabolism of the dietary carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), by N2-hydroxylation to a proximate carcinogen. Our previous study demonstrated that PhIP, in combined with the dextrin sulfate sodium (DSS)-induced colitis, induces colon carcinogenesis in hCYP1A mice. Here, we employed whole exome sequencing and found multiple gene mutations in PhIP/DSS-induced colon tumors. Mutations in the exon 3 of Ctnnb1/β-catenin, however, were the predominant events. We further sequenced the key fragments of Apc, Ctnnb1, and Kras, because mutations of these genes in the humans are commonly found as the drivers of colorectal cancer. Mutations on either codon 32 or 34 in the exon 3 of Ctnnb1 were found in 39 out of 42 tumors, but no mutation was found in either Apc or Kras. The sequence context of codons 32 and 34 suggests that PhIP targets +3G in a TGGA motif of Ctnnb1. Since mutations that activate Wnt signal is a major driving force for human colorectal cancers, we conclude that the mutated β-catenin is the driver in PhIP/DSS-induced colon carcinogenesis. This result suggests that the colon tumors in hCYP1A mice mimic human colorectal carcinogenesis not only in the dietary etiology involving PhIP, but also in the aberrant activation of the Wnt signaling pathway as the driving force.

Genetic alterations in Japanese extrahepatic biliary tract cancer

“…These frequencies are consistent with previous studies for Caucasian EBDC (17.5-75%) (16,36,37) and GBC (46.2-63%) (15,36,38). Additionally, the frequencies of KRAS mutations in Japanese EBDC (27.2%) and GBC (14.3%) are in agreement with previous studies (16,19,20,36,37).…”

δ- and γ-tocopherols inhibit phIP/DSS-induced colon carcinogenesis by protection against early cellular and DNA damages

“…These treatment changes not only improved the health of the mice considerably, but also increased colon tumor incidence to 100% (from previous ∼86%) and multiplicity to ∼6 tumors per mouse (from previous ∼4 tumors). The increased tumor incidence in mice may be attributed to longer exposure to the PhIP carcinogen, which leads to greater likelihood of cells acquiring key mutations that drive the PhIP/DSS colon carcinogenesis .…”

From the Cover: PhIP/DSS-Induced Colon Carcinogenesis in CYP1A-Humanized Mice and the Possible Role of Lgr5+ Stem Cells

“…Analysis for Ctnnb1/b-catenin mutation hot spots was performed using Sanger sequencing method as described previously in Wang et al (2015). Ctnnb1/b-catenin exon 3 was directly amplified from extracted DNAs using by Advantage 2 PCR kit (Clontech Laboratories, Inc, Mountain View, California) and primers, CTAACATACTCTGTTTTTACAGCTGAC and CAGCTACTTGCTCTT GCGTGA (250bp product size).…”

“…Previous study in our lab showed a majority of PhIP/DSS-induce colon tumors carried dominant active mutations of the Ctnnb1/ b-catenin gene, chiefly in codon 32 and 34 of exon 3 (Wang et al, 2015). To determine whether these mutations can be detected in earlier preneoplastic colon, laser capture microdissection and targeted sequencing were employed.…”

“…Histopathologic and biochemical evaluations revealed, at as early as 10 weeks after PhIP/DSS treatments, tubular adenocarcinomas with marked overexpression of key proteins in Wnt signaling pathway (ie, b-catenin), cell regulation (ie, c-Myc and cyclin D1), and inflammation (ie, iNOS and COX-2). In addition, the majority of the PhIP/DSS-induced colon tumors were shown to carry dominant active mutations in the Ctnnb1/b-catenin gene, specifically at the key recognition site for ubiquitin-mediated proteasome degradation (Wang et al, 2015).…”