Genetic Analysis of HIV-1 during Rapid Progression to AIDS in an Apparently Healthy Man

Abstract

We encountered a case of HIV-1 infection in a previously healthy man, which was characterized by rapid progression to AIDS and death within 7 months in association with high levels of antigenemia throughout the clinical course and no humoral immune response for at least 6 months. Genetic changes of the third variable domain (V3) of the envelope gene of HIV-1 in serum samples were analyzed at four time points during his rapid clinical course. The nucleotide changes were confined to a maximum of three substitutions among 105 nucleotides of the V3 region. A major population of the viral clones in this patient showed one amino acid substitution from aspartic acid (a negatively charged amino acid) to lysine (a positively charged amino acid) at position 30 from the first cysteine of the V3 loop. This substitution was thought to be associated with phenotypic changes, and viruses with this sequence in the V3 region had a strong syncytium-inducing ability in MT-4 cells. It appears that the lack of a humoral immune response accelerated disease progression in our patient and a genetic change that appeared to produce a phenotypic change occurred at an early stage of the disease.

Relationship of HIV‐1 Envelope V2 and V3 Sequences of the Primary Isolates to the Viral Phenotype

“…The hypervariable domains, designated V1 through V5, are interspersed with conserved regions along the gp120 molecule (20,22,33). Sequence variation in the env gene can affect the biological phenotype with respect to the replication rate in different cells, as well as cytotropism and the capacity to induce syncytia in vitro (4,5,8,13,15,23,24,26,35).A comparative analysis of a large set of V3 sequences derived from primary or culture-adapted isolates revealed that an acidic amino acid or alanine predominates at position 25 among the macrophage tropic isolates, whereas a basic or neutral amino acid at this site is associated with non-conservative basic amino acid substitutions mainly at positions 11, 24, and 32 and that both features correlate with the T cell line tropism of the viral isolates (19). Moreover, sequence analysis of a series of primary isolates demonstrated that non-syncytium inducing (NSI)…”

“…The hypervariable domains, designated V1 through V5, are interspersed with conserved regions along the gp120 molecule (20,22,33). Sequence variation in the env gene can affect the biological phenotype with respect to the replication rate in different cells, as well as cytotropism and the capacity to induce syncytia in vitro (4,5,8,13,15,23,24,26,35).…”

Genomic and biological alteration of a human immunodeficiency virus type 1 (HIV-1)-simian immunodeficiency virus strain mac chimera, with HIV-1 Env, recovered from a long-term carrier monkey

“…For amplification of the viral DNA sequence from PBMCs, nested PCR was used. The sense primer used for the first PCR was MK650 (Oka et al, 1994) (nt 6935-6959 in NL432) and the antisense primer was VdBR1 (5' CTTCTCCAATTGTCCCTCATATCGCC 3', nt 7631-7656 in NL432), For the second PCR, the sense primer used was VdBF1 (5' CAGGCCAGTAGTATCAACTCAACTGC 3', nt 6967--6992 in NL432) and the antisense primer was YT001 (Oka et aL, 1994) (nt 7304-7329 in NL432), covering the V3 region. The buffer conditions were as described by Oka eta].…”

Infection of an HIV‐1/SIVmac Chimeric Virus Having HIV‐1 env to Macaque Monkeys via the Vaginal Cavity

“…Virus isolation was attempted from PBMC and the cell fraction of vaginal wash by cocultivation with a human T-cell line (M8166) or concanavalin A-stimulated human or macaque PBMC. The detection of proviral DNA was performed from PBMC, surface and abdominal lymph nodes, as well as the spleen as described (16). Briefly, DNA extraction was performed by digestion with proteinase K in a PCR buffer, and a nested PCR was carried out for detecting the HIV-1 env region of proviral DNA.…”

“…Primers used were MK650 (sense) and V3BR1 (5'-CTTCTCCATTGTC-CCTCATATCGCC-3' (anti-sense), 7656-7631 nt in an HIV-1 strain, pNL432 (1)) for the first amplification and V3BF1 (5'-CAGGCCAGTAGTCAACIVAACT-CAACTGC-3' (sense), 7304-7329 nt in pNL432) and YT001 for the second amplification, respectively. The primers, MK650 and YT001, and PCR buffer were described previously (16). The reaction consisted of 30 cycles of denaturation for 60 sec at 94 C, annealing for 60 sec at 55 C and elongation for 60 sec at 72 C. Antibody response was assessed by the particle agglutination (PA) method (Serodia HIV, Fujirebio Inc., Tokyo) and Western blotting as described previously (7).…”