Genetic diversity of SIRE-1 retroelements in annual and perennial glycine species revealed using SSAP

Abstract

Sequence Specific Amplification Polymorphisms (SSAP) were used to measure the distribution and structure of SIRE-1 retroelement populations in annual and perennial Glycine species. For SSAP analysis, primers corresponding to a region immediately upstream of the 3'LTR of the soybean retroelement SIRE-1 were chosen. Analysis reveals that SIRE-1 is present throughout the Glycine genus and shows that the annual species have similar SIRE-1 populations whilst the perennial species have much more distinct and diverse populations. The high number of species-specific subgroups suggest that SIRE-1 has been active and evolving independently in each species during the course of Glycine evolution.

Ulmus americana (Ulmaceae) is a polyploid complex

“…Flow cytometry was carried out on a Partec PA II flow cytometer using the Partec CyStain UV precise P kit (Partec GmbH, Münster, Germany) according to the manufacturer's instructions. Fresh leaf tissue of Glycine max ‘Williams 82,’ with a monoploid genome size (1Cx‐value: DNA content of the monoploid chromosome set [Greilhuber et al, 2005]) of 1.13 pg (Chesnay et al, 2007), was used as an internal standard. Approximately 0.5 cm 2 of Ulmus tissue was co‐chopped with leaf tissue of the internal standard (<0.5 cm 2 ) with a double‐sided razor blade in 400 µL of extraction buffer.…”

SIRE1 retrotransposons in barley (Hordeum vulgare L.)

“…One E1 E2 E3 E4 R1 R2 R3 R4 L1 L2 L3 L4 E1 -14 7 27 17 23 20 36 33 11 25 11 E2 -14 0 0 25 8 25 23 27 20 25 E3 -7 7 29 7 25 27 6 12 11 E4 -0 25 8 25 23 27 20 of these studies was performed by Chesnay et al [24] who studied the distribution and structure of SIRE1 retroelement in Glycine species using Sequence Spe cific Amplification Polymorphisms (SSAP). In that study, primers were designed for the region immedi ately upstream of the 3' LTR of SIRE1.…”

“…The primer sequence used for IRAP was 5' CAGTTATGCAAGTGGGATCAGCA 3' as obtained from Chesnay et al [24]. PCR was per formed by using a thermal cycler (Bio Rad, T100 TM ) in a total volume of 20 µL, containing 3.5 µL of sterile distilled water, 0.5 µL of 10 mmol/µL dNTP mixture (0.25 mM/µL), 4 µL of primer (1 µM/µL), 2 µL of 10 ng/µL template genomic DNA and 10 µL of 2× Sapphire enzyme mix (Takara, RR350A).…”

“…This result was supported by different studies. They showed that SIRE1 is closely related to sireviruses found in the genomes of other legumes [24,33].…”

“…SIRE1 retrotransposon has been investigated on different plants. In addition to Glycine max, Cicer arietinum, Vicia faba, and Pisum sativum, experimental evidence suggests that Sireviruses are present in high numbers in other species such as legumes [8,24,33], beets [35], and bananas [36]. There are also recent reports on ret rotransposons like Tvv1 to be dispersed unevenly among very distant species [37].…”