Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa

Abstract

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

The influence of SLC22A1 rs622342 and ABCC8 rs757110 genetic variants on the efficacy of metformin and glimepiride combination therapy in Egyptian patients with type 2 diabetes

“…Additionally, the first to explore the minor allele frequency of rs622342 SLC22A1 genetic variant in Egyptian patients. The MAF in our sample (0.189) was considered lower than previously reported MAFs in Caucasians, which was 0.37 19 , and 0.2534 47 and 0.245 in Indian populations 48 , however it was almost similar to MAF (0.18) in a Cape Admixed population of South Africa 49 .…”

Genetic Diversity in Drug Transporters: Impact in African Populations

“…Nineteen protein-altering SLC22A1 SNPs and one intronic SNP with documented impact on response to metformin were evaluated within a healthy Cape Admixed population (n = 100) and the allele frequencies were compared with those in other ethnic groups (Luhya, Yoruba, Native American/Hispanic, Caucasian, and Han Chinese). 27 Variants rs34447885 and rs36103319 were only present in African participants (both at a frequency of 0.01 in the Cape Admixed population), whereas rs34130495 and rs12208357 were not observed in African populations but were present in other populations (Table S2). Therefore, drugs that are substrates for OCT1 may have different response profiles in the Cape Admixed and African populations than in Caucasian and Asian populations.…”

Genetic polymorphisms of organic cation transporter 1 (OCT1) and responses to metformin therapy in individuals with type 2 diabetes

“…Although OCT1 polymorphisms have also been identified in Africans Americans and African populations such as the Xhosas (South Africa), Luhyas (Kenya), and the Yorubas (Nigeria), their effects on metformin responses remain unknown. [ 38 , 39 ] In light of this, there is a robust need to complete association studies between OCT1 polymorphisms and therapeutic responses to metformin, by evaluating a comprehensive and representative dataset.…”