Background Achieving the blood pressure treatment target in individuals with hypertension is a serious global health challenge. Furthermore, the actual burden of uncontrolled hypertension is poorly understood, especially in the developing countries. Therefore, this study comprehensively examined the prevalence and factors associated with uncontrolled hypertension in individuals receiving care at the primary healthcare facilities in the rural areas of Mkhondo Municipality in the Mpumalanga Province, South Africa. Methods In this cross-sectional study, 329 individuals attending care for hypertension were recruited from January 2019 to June 2019 at three primary healthcare centres, namely, Piet Retief hospital, Mkhondo town clinic and Thandukukhanya community health centre. Uncontrolled hypertension was defined as systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg in accordance with the South African Hypertension Society guideline (2014). Multiple logistic regression (Forward LR method) analysis was used to identify the significant determinants of uncontrolled hypertension. Results The majority of the participants were 55 years old and above (69.0%), Zulus (81.2%), non-smokers (84.19%) and had been diagnosed with hypertension for more than a year prior to the study (72.64%). The overall prevalence of uncontrolled hypertension was 56.83% (n = 187) with no significant difference between sexes, 57.38% male versus 56.88% female, respectively. In the multiple logistic regression model analysis after adjusting for confounding variables, obesity (AOR = 2.90; 95% CI 1.66–5.05), physical activity (AOR = 4.79; 95% CI 2.15–10.65) and HDL-C (AOR = 5.66; 95% CI 3.33–9.60) were the significant and independent determinants of uncontrolled hypertension in the cohort. Conclusion The high prevalence of uncontrolled hypertension in the study setting can be largely attributed to obesity, physical activity and dyslipidaemia. Treatment will require the collaborative efforts of individuals, clinicians and health authorities. All these determinants should be addressed decisively so as to achieve the treatment blood pressure targets in the study population.

This study examines the rate and the influencing factors of glycemic control among adult residents living with DM in Mkhondo Municipality of South Africa. In this cross-sectional study, 157 individuals attending care for DM were recruited. Glycemic control status was categorized as poor if glycated hemoglobin (HbA1c) > 7% and very poor if HbA1c ≥ 9%. Multivariate regression analysis was used to identify the significant determinants of poor and very poor glycemic control. The majority of the study participants were females (84.71%) and above 45 years old (88.55%). The overall prevalence of poor glycemic control was 77.71% (n = 122), while very poor glycemic control occurred in 50.6% (n = 80) of the study cohort. In the multivariate logistic regression model analysis, African traditional [AOR = 0.15; 95% confidence interval (95% CI) 0.04–0.57], fast food consumption (AOR = 5.89; 95% CI 2.09–16.81), elevated total cholesterol (TC) [odds ratio (OR) = 2.33; 95% CI 1.50–5.17], elevated low-density lipoprotein cholesterol (LDL-C) (AOR = 5.28; 95% CI 1.89–14.69), and triglyceride (TG) (AOR = 4.39; 95% CI 1.48–13.00) were the independent and significant determinants of poor glycemic control. Age (AOR = 0.46; 95% CI 0.23–0.92) was the only independent and significant determinant of very poor glycemic control. We found a high rate of poor glycemic control (77.71%) possibly attributed to religious affiliation, fast food consumption, and dyslipidemia. On the contrary, about half of the study sample had very poor glycemic control (HbA1c ≥9%), which was predominant among younger cohort with diabetes mellitus. Interventions aimed at improving glycemic control in this population must also target religious practice, dietary patterns and dyslipidemia as well as tailored-approach for young people.

Searching for new natural bioactive capping agents represent an urgent priority in the green synthesis of metal nanoparticles. Additionaly, the biosaftey of metal nanparticles is a major concern especially in medical applications. Recently, the use of pharmacollogicaly active natural products as capping agents has been deployed to avoid toxic effects during the nanoparticles preparation and to enhance their drugability compared with convential drugs. Helichrysum foetidum is a South African medicinal plant used in folk medicine for the treatment of different human pathologies, and it is known to contain a variety of bioactive compounds. Herein, the total extract and two pure chalcones, helichrysetin and helichrysin, isolated from the same plant were successfully used to synthesize quasi-monodispersed gold nanoparticles in the size range of 2-12 nm. The bio-evaluation of samples indicated that the AuNP/capping agent conjugates are biostable, and have different biological profiles from the total extract/pure compounds. The enzymatic inhibition assays showed significant inhibition by the total extract, helichrysetin and their gold nanoparticles. Interestingly, a similar activity was observed for glucose uptake in HEK293 treated cells. On the other hand, all the tested samples relatively demonstrated no cytotoxicity when tested against the HaCaT keratinocytes. In conclusion, the study demonstrated potential enhancement of glucose uptake in mammalian kidney cells, and inhibition of carbohydrate-hydrolysing enzymes by green synthesized gold nanoparticles of H. foetidum. It also provides a therapeutic appraisal of AuNPs/chalcones conjugate towards the development of antidiabetes drugs derived from H. foetidum and its gold nanoparticles.

The U.S. President Barack Obama has announced, in his State of the Union address on January 20, 2015, the Precision Medicine Initiative, a US$215-million program. For global precision medicine to become a reality, however, biological and environmental "variome" in previously understudied populations ought to be mapped and catalogued. Chief among the molecular targets that warrant global mapping is the organic anion-transporting polypeptide 1B1 (OATP1B1), encoded by solute carrier organic anion transporter family member 1B1 (SLCO1B1), a hepatic uptake transporter predominantly expressed in the basolateral side of hepatocytes. Human OATP1B1 plays a crucial role in the transport of a wide variety of substrates. This includes endogenous compounds such as bile salts as well as medicines, including benzylpenicillin, methotrexate, pravastatin, and rifampicin, and natural toxins microcystin and phalloidin. Genetic variations observed in the SLCO1B1 gene have been associated with altered in vitro and in vivo OATP1B1 transport activity, and consequently influencing patients' response to medicines, toxins, and susceptibility to common complex diseases. Well-characterized haplotypes, *5 (RS4149056C) and *15 (RS4149056T), have been associated with a strikingly reduced uptake of multiple OATP1B1 substrates, including estrone-3-sulfate, estradiol-17β-d-glucuronide, atorvastatin, cerivastatin, pravastatin, and rifampicin. In particular, RS4149056C is observed in 60% of the Cape admixed (CA) population and is associated with increased plasma concentrations of many statins as well as fexofenadine and repaglinide. We designed and optimized a SNaPshot minisequencing panel to characterize the variants of relevance for precision medicine in the clinic. We report here the first study on allele and genotype frequencies for 10 nonsynonymous, 4 synonymous, and 6 intronic single-nucleotide polymorphisms of SLCO1B1 in the Zulu and CA populations of South Africa. These variants are further contextualized here, in relation to their potential clinical relevance. These observations collectively contribute to current efforts to advance global precision medicine in understudied populations and resource-limited regions of the world.

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.