Genome‐based detection methods of Macrobrachium rosenbergii nodavirus, a pathogen of the giant freshwater prawn, Macrobrachium rosenbergii: dot‐blot, in situ hybridization and RT‐PCR

Abstract

The availability of specific and rapid detection methods is essential for monitoring the health status of farmed species, particularly in viral diseases as in this case early diagnosis is a critical factor in containing disease outbreaks. Three complementary genome-based methods were developed for the detection of Macrobrachium rosenbergii nodavirus (MrNV), i.e. dot-blot hybridization, in situ hybridization and reverse transcriptase-polymerase chain reaction (RT-PCR). Detection limits were established for dot-blot hybridization and RT-PCR and are c. 7 fg and 8 pg of viral RNA, respectively. In situ hybridization indicated that infection was confined to the striated muscle tissue. As a result of its sensitivity, RT-PCR can be used for in-depth investigations to examine the extent of the viral infection and establish the onset of infection in hatcheries. The application of RT-PCR on samples collected from prawn farms in China showed the possible use of this method in routine health monitoring.

White Tail Disease of Freshwater Prawn, Macrobrachium rosenbergii

“…The protocol for the RT-PCR for detection of MrNV/XSV developed by Sri Widada et al [24] and Sahul Hameed et al [20,21] is recommended for all situations. MrNV and XSV can be detected by RT-PCR separately using a specific set of primers or these two viruses can be detected simultaneously using a single-tube one-step multiplex RT-PCR [32,36].…”

“…Pathognomonic oval or irregular basophilic cytoplasmic inclusion bodies are demonstrated in the target tissues by histology [1,6]. The presence of MrNV in infected cells can be demonstrated in histological sections using a DIG-labelled DNA in situ hybridisation probe specific for MrNV [24].…”

“…However, proper preventive measures, such as screening of brood stock and PL, and good management practices may help to prevent WTD in culture systems. As the life cycle of M. rosenbergii is completed under controlled conditions, specific pathogen free (SPF) brood stock and PL can be produced by screening using sensitive diagnostic methods such as reverse-transcription polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) [16,24,36]. Hayakijkosol and Owens [4] reported a sequence specific dsRNA against protein B2 produced RNAi that was able to functionally prevent and reduce mortality in WTD-infected redclaw crayfish.…”

Production and Application of Polyclonal Antibodies Against Recombinant Capsid Protein of Extra Small Virus of Macrobrachium rosenbergii

“…Several tests have been reported for detecting WTD which include dot-blot hybridization, in situ hybridization and reverse-transcriptase polymerase chain reaction (RT-PCR) [11], loop-mediated isothermal amplification (LAMP) [4], sandwich enzyme-linked immunosorbent assay (S-ELISA) [7] and triple antibody sandwich enzymelinked immunosorbent assay (TAS-ELISA) [6] for MrNV; dot-blot hybridization and RT-PCR for XSV [12] and onestep multiplex RT-PCR [13,16] for the detection of both MrNV and XSV. Sahul Hameed et al [9] reported western blot and ELISA for the detection of both MrNV and XSV.…”

“…cDNA was synthesized from 1 lg of RNA using First Strand cDNA Synthesis Kit (Fermentas) with random hexamer primers. PCR was performed using specific primers (ATGGCTAGAGGTAA ACAAAATTC and ACAACCTAATTATTGCCGAC for MrNV [11] and CCACGTCTAGCTGCTGAC and CGGAA TAATGCCTAACCAAT for XSV [15]). The reaction mixture (25 lL) contained 12.5 lL PCR master mix (Fermentas), 25 pmol each of forward and reverse primers and 1 lL of cDNA.…”