Genome Biology of Actinobacillus pleuropneumoniae JL03, an Isolate of Serotype 3 Prevalent in China

Abstract

Actinobacillus pleuropneumoniae is the etiologic agent of porcine contagious pleuropneumonia, a cause of considerable world wide economic losses in the swine industry. We sequenced the complete genome of A. pleuropneumoniae, JL03, an isolate of serotype 3 prevalent in China. Its genome is a single chromosome of 2,242,062 base pairs containing 2,097 predicted protein-coding sequences, six ribosomal rRNA operons, and 63 tRNA genes. Preliminary analysis of the genomic sequence and the functions of the encoded proteins not only confirmed the present physiological and pathological knowledge but also offered new insights into the metabolic and virulence characteristics of this important pathogen. We identified a full spectrum of genes related to its characteristic chemoheterotrophic catabolism of fermentation and respiration with an incomplete TCA system for anabolism. In addition to confirming the lack of ApxI toxin, identification of a nonsense mutation in apxIVA and a 5′-proximal truncation of the flp operon deleting both its promoter and the flp1flp2tadV genes have provided convincing scenarios for the low virulence property of JL03. Comparative genomic analysis using the available sequences of other serotypes, probable strain (serotype)-specific genomic islands related to capsular polysaccharides and lipopolysaccharide O-antigen biosyntheses were identified in JL03, which provides a foundation for future research into the mechanisms of serotypic diversity of A. pleuropneumoniae.

Comparative Genomic Characterization of Actinobacillus pleuropneumoniae

“…19 Mb ϳ2.33 Mb in length. The average GC content of each genome was 41%, which was consistent with that of an entire A. pleuropneumoniae chromosome (47). The median number of CDSs per strain was 2,174, the largest number was 2,223 for serovar 4 strain M62, and the least was 2,096 for serovar 12 strain 1096.…”

“…Antigenic differences in the LPS can further determine A. pleuropneumoniae subtypes within a same capsular serovar (13). The metabolic and virulent characteristics of this pathogen have been systematically described based on the prior knowledge and two complete genomes (18,47), but the molecular basis and evolutionary mechanism of serotypic diversity are still not well explained due to the lack of sequence information. To investigate the associations of serovar diversity with the underlying genetic components, more serovar-related genomic islands involved in the biosynthesis of capsular and lipopolysaccharide antigens should be decoded at the pan-genome level of A. pleuropneumoniae.…”

Identification of an Outer Membrane Protein from Actinobacillus Pleuropneumoniae Serotype 7

“…The OMP is very conservative among the surrogates from different isolates of serotype 3, 5, 6, and 7 by protein analysis, NCBI BLAST, and phylogenetic analysis. Complete genomic sequences now available will facilitate studies on pathogenesis and protective responses of the virulence factors [5,17]. The availability of the OMP sequence now makes it possible to study its role in virulence and pathogenesis, and further clarifying the epitopes and domains relevant to opsonic and protective responses.…”

Isolation and genetic characterization of an Actinobacillus pleuropneumoniae serovar K12:O3 strain

“…As a fourth genetic study, the nucleotide sequence of the o-ps gene of strain QAS106 (14,186 bp) was determined and compared with that of serovars 3 24 and 6, 23 as the ID test indicated that 1) the strain QAS106 might express an O-PS that was antigenically similar to that of serovars 3 and 15; 2) the O-PS structures among serovars 3, 8, and 15 are chemically identical 2,6,19 ; and 3) serovars 3, 6, 8, and 15 often cross-react with conventional serotyping methods such as slide agglutination. 6 To amplify the o-ps genes, PCR was performed using 2 primers, erpA-F2 (5′-ACTCGTAAAC GAAGATTCGGGTTATCYTCGCC-3′) and rpsU-R1 (GCGTGACGTTTAGCTAAAGATGCTTTTTCAC GTTT-3′), which were designed based on the published data as described previously, 23 and a commercial PCR enzyme, c which was essentially used following the supplier's protocol.…”

“…13 In addition, the nucleotide sequences of the o-ps genes of serovars 8 and 15 (13, 969 and 14,186 bp, respectively) were determined in the current study, for the first time, by the method used for strain QAS106. The o-ps gene of strain QAS106 contained 13 ORFs, the deduced amino acid sequences of which were identical or nearly identical to those of the serovar 3 strain JL03 24 and serovar 15 strain HS143 ( Table 1), suggesting that strain QAS106 would express O-PS, which shared antigenic determinants with those of serovars 3 and 15. The atypical strain QAS106 could therefore be named O3, as the O-PS molecules of serovars 3 and 15 are chemically identical.…”