Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid

Abstract

While CRISPR-Cas9-mediated genome editing has transformed yeast research, current plasmids and cassettes for Cas9 and guide-RNA expression are species specific. CRISPR tools that function in multiple yeast species could contribute to the intensifying research on non-conventional yeasts. A plasmid carrying a pangenomic origin of replication and two constitutive expression cassettes for Cas9 and ribozyme-flanked gRNAs was constructed. Its functionality was tested by analyzing inactivation of the ADE2 gene in four yeast species. In two Kluyveromyces species, near-perfect targeting (≥96%) and homologous repair (HR) were observed in at least 24% of transformants. In two Ogataea species, Ade− mutants were not observed directly after transformation, but prolonged incubation of transformed cells resulted in targeting efficiencies of 9% to 63% mediated by non-homologous end joining (NHEJ). In an Ogataea parapolymorpha ku80 mutant, deletion of OpADE2 mediated by HR was achieved, albeit at low efficiencies (<1%). Furthermore the expression of a dual polycistronic gRNA array enabled simultaneous interruption of OpADE2 and OpYNR1 demonstrating flexibility of ribozyme-flanked gRNA design for multiplexing. While prevalence of NHEJ prevented HR-mediated editing in Ogataea, such targeted editing was possible in Kluyveromyces. This broad-host-range CRISPR/gRNA system may contribute to exploration of Cas9-mediated genome editing in other Saccharomycotina yeasts.

Kluyveromyces marxianus as a robust synthetic biology platform host

“…Combined with CRISPR-Cas9 genome editing ( Fig. 1) (6)(7)(8)(9), these results establish a full set of tools for use of K. marxianus as a synthetic biology host and future exploration of its biology on a genome-wide scale.…”

“…These tools would enable rapid strain development, by generating genetic diversity and facilitating stacking of industrially important traits. The CRISPR-Cas9 gene editing system has been used in many yeasts including S. cerevisiae, S. pombe, Y. lipolytica, K. lactis and recently K. marxianus (6)(7)(8)(9). Genome editing in K. marxianus should allow manipulation of known genetic targets.…”

Maltotriose consumption by hybridSaccharomyces pastorianusis heterotic and results from regulatory cross-talk between parental sub-genomes

“…The gRNA spacer sequences ( SeMALT1 5’ CCCCGATATTCTTTACACTA 3’, SeAGT1 5’-AGCTTTGCGAAAATATCCAA-3’) and the structural gRNA sequence were flanked at their 5’ ends by the Hammerhead ribozyme (HH) and at their 3’ ends by the Hepatitis Delta Virus ribozyme (HDV) (Gao and Zhao 2014). The HH-gRNA-HDV fragment was flanked on both ends with a BsaI site for further cloning (Juergens et al 2018; Gorter de Vries et al 2017). Plasmids pUDP091 (gRNA SeMALT1 ) and pUDP090 (gRNA SeAGT1 ) were constructed by Golden Gate cloning by digesting pUDP004 and the gRNA-carrying plasmid (pUD631 and pUD634, respectively) using BsaI and ligating with T4 ligase (Engler et al 2008).…”

A CRISPR–Cas9 system for multiple genome editing and pathway assembly in Candida tropicalis

“…In S. cerevisiae (Deaner, Mejia, & Alper, 2017) and Ogataea parapolymorpha (Juergens et al, 2018), multiple sgRNAs can be expressed using a polycistronic transcript. To simplify the process of CRISPR cassette construction, the sgRNA targeting URA3 and the sgRNA targeting ADE2 were linked together using a 20-bp DNA linker (Juergens et al, 2018), and the fused sgRNA was expressed under control of the P GAP1 promoter (cassette B, Figure 5a).…”