Genome-wide analysis of long noncoding RNAs affecting floral bud dormancy in pears in response to cold stress

Abstract

The versatile role of long noncoding RNAs (lncRNAs) in plant growth and development has been established, but a systematic identification and analysis of lncRNAs in the pear has not been reported. Bud dormancy is a crucial and complicated protective mechanism for plants in winter. The roles of lncRNAs in the dormancy process remain largely unclear. In this study, we induced pear floral buds to enter into different dormant statuses by simulating four different chilling accumulation conditions. Then, a time series of RNA-seq analysis was performed and we identified 7,594 lncRNAs in Pyrus pyrifolia ‘Huanghua’ that have not been identified. The sequence and expression of the lncRNAs were confirmed by PCR analysis. In total, 6,253 lncRNAs were predicted to target protein-coding genes including 692 cis-regulated pairs (596 lncRNAs) and 13,158 trans-regulated pairs (6,181 lncRNAs). GO analysis revealed that most of lncRNAs target genes were involved in catalytic activity, metabolic processes and cellular processes. In the trend analysis, 124 long-term cold response lncRNAs and 80 short-term cold response lncRNAs were predicted. Regarding the lncRNA-miRNA regulatory networks, 59 lncRNAs were identified as potential precursors for miRNA members of 20 families, 586 lncRNAs were targets of 261 pear miRNAs and 53 lncRNAs were endogenous target mimics (eTMs) for 26 miRNAs. In addition, three cold response lncRNAs, two miRNAs and their target genes were selected for expression confirmed. The trend of their expression was consistent with the predicted relationships among them and suggesting possible roles of lncRNAs in ABA metabolic pathway. Our findings not only suggest the potential roles of lncRNAs in regulating the dormancy of pear floral buds but also provide new insights into the lncRNA-miRNA-mRNA regulatory network in plants.

ABA and Bud Dormancy in Perennials: Current Knowledge and Future Perspective

“…In peach, several microRNAs, siRNAs and lncRNAs have been found to be correlated to bud dormancy release for instance miR319, miR6285, miR2275 and D4ncRNA (intronic ncRNA in DAM4) (Figure 1) [204]. Several long ncRNAs (>200 nt), isolated from popular buds at different dormant stage, were reported to be involved in regulating endodormancy release, for example, two lncRNAs acting as endogenous target mimics for gma-miRNA396h, which itself targets CYP707As [205].…”

Downregulation of lncRNA PpL-T31511 and Pp-miRn182 Promotes Hydrogen Cyanamide-Induced Endodormancy Release through the PP2C-H2O2 Pathway in Pear (Pyrus pyrifolia)

“…PpPP2C1 (XM_009364194.2, a transcript of ncbi_103952578) was predicted as the potential target gene of Pp-miRn182 (a novel pear miRNA, AAUUUUGCAAACUAAAUGACAUG) ( Figure 3 a). More interestingly, the lncRNA PpL-T31511 (identified in our previous study [ 45 ], NCBI: MW856021) was predicted to contain the functional unit pri- Pp-miRn182 ( Figure 3 b). In other words, PpL-T31511 (pri- Pp-miRn182 ) could be digested properly to form the precursor to Pp-miRn182 (pre- Pp-miRn182 , or Pp- MIRn182 ), and eventually to form the mature Pp-miRn182 .…”

“…Based on our previous study [ 45 ] and the results of this study ( Figure S1 ), the lateral floral buds cultivated in water in cold storage for 15 days were determined as being in the endodormancy phase. Accordingly, the shoots cultivated in water in cold storage for 15 days were transferred to the lab.…”

“…LncRNAs can function as precursors or targets of miRNAs to regulate plant metabolic processes [ 44 ]. Although little is known regarding the characteristic features of dormancy-related lncRNAs, the publication of lncRNA data affecting floral bud dormancy in pear plants provides an opportunity for further study of the regulatory mechanism of lncRNAs during endodormancy release [ 45 ]. LncRNAs are considered to interact with miRNAs and affect the expression of glutathione peroxidase genes, causing them to participate in the ROS scavenging system during pear bud endodormancy [ 45 ].…”

From “Dark Matter” to “Star”: Insight Into the Regulation Mechanisms of Plant Functional Long Non-Coding RNAs

“…The majority of these EVLncRNAs belong to the model plant Arabidopsis thaliana ( Figure 1 ). As shown in Figure 2 , lncRNAs were found to regulate the downstream gene expression in cis or trans and play crucial roles in bud dormancy (Li et al, 2020 ), flowering time (Heo and Sung, 2011 ; Wang Z. W. et al, 2014 ; Kim et al, 2017 ), seedling photomorphogenesis (Wang Y. et al, 2014 ), root organogenesis (Ariel et al, 2014 ), sexual reproduction (Fan et al, 2016 ), gene silencing (Huang et al, 2011 ), and response to biotic and abiotic stress (Wunderlich et al, 2014 ; Kindgren et al, 2018 ; Zhao et al, 2018 ). In other words, the regulatory role of lncRNAs is extensive in eukaryotes (Long et al, 2017 ).…”