Genome-wide identification of housekeeping genes in maize

Abstract

In the wake of recent progress of high throughput transcriptome profiling technologies, extensive housekeeping gene mining has been conducted in humans. However, very few studies have been reported in maize (Zea mays L.), an important crop plant, and none were conducted on a genome -wide level. In this study, we surveyed housekeeping genes throughout the maize transcriptome using RNA-seq and microarray techniques, and validated the housekeeping profile with quantitative polymerase chain reaction (qPCR) under a series of conditions including different genotypes and nitrogen supplies. Seven microarray datasets and two RNA-seq libraries representing 40 genotypes at more than 20 developmental stages were selected to screen for commonly expressed genes. A total of 1,661 genes showed constitutive expression in both microarray and RNA-seq datasets, serving as our starting housekeeping gene candidates. To determine for stably expressed housekeeping genes, NormFinder was used to select the top 20 % invariable genes to be the more likely candidates, which resulted in 48 and 489 entries from microarray and RNA-seq data, respectively. Among them, nine genes (2OG-Fe, CDK, DPP9, DUF, NAC, RPN, SGT1, UPF1 and a hypothetical protein coding gene) were expressed in all 40 maize diverse genotypes tested covering 16 tissues at more than 20 developmental stages under normal and stress conditions, implying these as being the most reliable reference genes. qPCR analysis confirmed the stable expression of selected reference gene candidates compared to two widely used housekeeping genes. All the reference gene candidates showed higher invariability than ACT and GAPDH. The hypothetical protein coding gene exhibited the most stable expression across 26 maize lines with different nitrogen treatments with qPCR, followed by CDK encoding the cyclin-dependent kinase. As the first study to systematically screen for housekeeping genes in maize, we identified candidates by examining the transcriptome atlas generated from RNA-seq and microarray technologies. The nine top-ranked qPCR-validated novel housekeeping genes provide a valuable resource of reference genes for maize gene expression analysis.

Effect of Light- and Dark-Germination on the Phenolic Biosynthesis, Phytochemical Profiles, and Antioxidant Activities in Sweet Corn (Zea mays L.) Sprouts

“…The primers of internal gene Zm ACT (GenID: 100282267) were: forward 5′TGTGGCTTTGGGATCGTAGTC′3 and reverse 5′GAGCCACCGATCCAGACACT′3. Zm ACT is a widely used housekeeping gene [32] and is proved as a suitable reference gene for RT-PCR in maize, as reported previously [33]. Although the expressions of ACT were different during the germination period, as was reported before [34], the changes of expressions were identical with the target genes in our study.…”

Natural antisense transcripts are significantly involved in regulation of drought stress in maize

“…We also compared drought-induced fold change in expression of sense and antisense transcripts within NAT pairs, housekeeping genes (47), lncRNA (48), and non-NAT transcripts in 1000 bootstrap re-samples. As expected, the fold change in expression of housekeeping genes under WS was closest to zero.…”

“…Expression of NAT genes in root tissues was compared between parental lines and offspring RILs using statistics developed for the analysis of maize lncRNAs (48), which were themselves used as reference, along with housekeeping genes (47). As expected, expression of the majority of housekeeping genes was centrally distributed, and did not vary significantly between parents and RILs (Figure 2D), in contrast to both sense (Figure 2E) and antisense transcripts in NAT pairs (Figure 2G).…”

“…TE annotation in the maize genome B73 is included in the RefGen_V3 genome annotations. NATs were characterized in comparison to non-NATs (transcripts not paired with NATs), housekeeping genes identified in the maize transcriptome (47), and high-quality lncRNAs in the maize reference genome (48,49). NATs only expressed in WW or WS in at least two samples were categorized as either WW or WS specifically expressed NATs.…”

Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis

“…Traditionally, housekeeper genes are preferred for RT-qPCR data normalisation as the protein products encoded by these genes are required for maintenance of fundamental cellular metabolism. Further, due to their assigned function, the expression of a housekeeper gene is assumed constant irrespective of the organ or tissue type under analysis, or the developmental stage or physiological condition(s) of the assessed species [13, 14]. Several housekeeper genes have been widely used in Arabidopsis thaliana ( CYCLOPHILIN ( CYC ), ACTIN2 ( ACT2 ) and ELONGATION FACTOR 1 α ( EF1 α; [15, 16])), rice ( ACTIN1 ( ACT1 ) and UBIQUITIN5 ( UBI5 ; [7, 11])), and sorghum ( SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ) and EUKARYOTIC INITIATION FACTOR 4α ( EIF4α ; [14])).…”