Genomic Organization and Fine Mapping of the Keratin 2e Gene (KRT2E): K2e V1 Domain Polymorphism and Novel Mutations in Ichthyosis Bullosa of Siemens

Abstract

We and others have previously shown that ichthyosis bullosa of Siemens, an autosomal dominant disorder characterized by epidermal thickening and blistering, is caused by mutations in the late-differentiation keratin K2e. Here, we have determined the genomic organization and complete sequence of the KRT2E gene, which consists of nine exons, spanning 7634 bp of DNA. The gene was mapped by high-resolution radiation-hybrid mapping to the interval between microsatellite markers D12S368 and CHLC.GATA11B02.1112. Several intragenic polymorphisms were detected, including an 18 bp duplication in exon 1, corresponding to the V1 domain of the K2e polypeptide. Genomic polymerase chain reaction conditions were optimized for all exons, and two novel mutations, N192Y in the 1A domain and E482K in the 2B domain of K2e, were found in ichthyosis bullosa of Siemens families. Mutations were excluded from 50 normal unrelated individuals by restriction analysis. These results emphasize that mutations in K2e underlie ichthyosis bullosa of Siemens and provide a comprehensive mutation detection strategy for ongoing studies of keratinizing disorders.

Ichthyosis bullosa of Siemens: its correct diagnosis facilitated by molecular genetic testing

“…The coding regions of the K2e gene ( KRT2E ) were amplified by polymerase chain reaction (PCR) using genomic DNA as a template. We employed oligonucleotide primers for amplification of all nine KRT2E exons, as reported elsewhere 5 . Specifically, the sense primer 5′‐ACCTAACACTCCCAGGGCCA‐3′ and antisense primer 5′‐CCCCATTCTCTGCTTTCCCT‐3′ were used for amplification of exon 7.…”

“…Despite these characteristic findings in IBS, however, it is very difficult to distinguish severe cases of IBS from mild cases of BCIE 2,5 , 6 . It is feasible that some patients with IBS may have been misdiagnosed as having mild BCIE, partly because IBS was thought to be an extremely rare condition.…”

Familial footpad hyperkeratosis and inheritance of keratin 2, keratin 9, and desmoglein 1 in two pedigrees of Irish Terriers

“…The assigned region of CFA 27 corresponds to human chromosome 12q, analogous to the region where the human keratin 2e gene has been mapped. 31 Assuming the arrangement of genes within the basic keratin gene cluster is similar in dogs and humans, this would imply that keratin 2e is located next to keratin 2p in both species and that the basic keratin genes (ie, 1, 4, 5, 6A, 8, and 18) are highly likely to cosegregate with keratin 2p, because the genetic distance between these genes would be < 1 cM in dogs, similar to the distance reported in humans. 32 Therefore, it is unlikely that these genes would be candidates to cause digital hyperkeratosis.…”

An autosomal recessive exfoliative ichthyosis with linkage to chromosome 12q13

“…Mutations in K2e and K5 were also excluded by amplification and sequencing of the entire coding regions using published primer sequences 18 . Sequencing of the coding sequence of the other genes harboured within the minimal region, such as retinoic acid receptor γ (RARG), sterol O‐acyltransferase 2 (SOAT2), integrin β7 (ITGB7) and insulin‐like growth factor binding protein‐6 (IGFBP6), did not reveal a mutation in this family.…”