Genotyping and molecular analysis of Enterocytozoon bieneusi isolated from immunocompromised patients in Iran

Mirjalali, Hamed; Mirhendi, Hossein; Meamar, Ahmad Reza; Mohebali, Mehdi; Askari, Zeynab; Mirsamadi, Elnaz Sadat; Rezaeian, Mostafa

doi:10.1016/j.meegid.2015.09.022

Cited by 40 publications

(29 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…3 U n C o r r e c t e d P r o o f The specie of E. bieneusi is the most frequent specie isolated from immunodeficient patients, animals (8), and even immunocompetent people (14,23). In the current study, also, these microorganisms had the highest prevalence in wild rats.…”

Section: Discussionmentioning

confidence: 99%

“…The research in Iran, on the prevalence of the microorganisms, have been performed, including the prevalence investigations in various animals and pigeons (11,12) (13), and HIV+/AIDS patients (14); however, the current study is a novel research in wild rats. Although, the parasites are self -limited in immunocompetent people, it can be life -threatening in immunodeficient patients (3,7).…”

Section: Objectivesmentioning

confidence: 99%

See 1 more Smart Citation

Molecular Diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. in Wild Rats of Southwest of Iran

Tavalla

Kazemi

Kateki

et al. 2018

Jundishapur J Microbiol

View full text Add to dashboard Cite

Background: Microsporidiosis is considered as an opportunistic infection in immunodeficient patients. Objectives: Due to the increasing prevalence of parasitic infections and immunodeficiency diseases as well as the transmission risk of microsporidia from animals to human, the aim of this study was to evaluate molecular diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. by the multiplex/nested polymerase chain reaction (PCR) and staining methods in wild rats of Ahvaz city, southwest of Iran. Methods: Initially, 160 stool samples were collected from wild rats in different parts of Ahvaz city. The samples were stained by the modified trichrome staining and explored microscopically. The DNA was extracted using the DNA stool kit and examined by multiplex/nested PCR. For differentiating the species of Encephalitozoon, the multiplex/nested PCR products were explored by the restriction fragment length polymorphism (RFLP) method using the restriction enzyme of Mnl1. Results: Of 160, 26 cases were suspected positive for microsporidia spore by the staining. Also, of 160, 18 cases were positive by the multiplex/nested PCR method, that 14 and 4 samples were detected as E. bieneusi and E. intestinalis, respectively. Of 14 E. bieneusi samples, 12 and 2 cases were detected as genotype D and M, respectively. Conclusions: The findings revealed a relatively high prevalence of microsporidia infection in wild rats of the city and these animals can be a source of microsporidiosis. Due to the zoonotic potential of the microorganisms, high -risk individuals should be receiving the information about the risk of direct and indirect contact with the infected animals.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Objectivesmentioning

confidence: 99%

Molecular Diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. in Wild Rats of Southwest of Iran

Tavalla

Kazemi

Kateki

et al. 2018

Jundishapur J Microbiol

View full text Add to dashboard Cite

show abstract

“…All DNA preparations were analyzed for the presence of E. bieneusi by nested PCR amplification of the ITS region of the rRNA gene with a set of specific primers. Primers and cycle parameters were designed by Mirjalal [28]. TaKaRa Taq DNA Table 1.…”

Section: Pcr Amplificationmentioning

confidence: 99%

Molecular detection of Enterocytozoon bieneusi in farm-raised pigs in Hainan Province, China: infection rates, genotype distributions, and zoonotic potential

Zhou

Zheng

et al. 2020

Parasite

View full text Add to dashboard Cite

Enterocytozoon bieneusi is a zoonotic fungal pathogen with a high degree of host diversity that can parasitize many animals, including humans. Pigs may play an important role in the epidemiology of E. bieneusi as reservoir hosts. Nevertheless, the genotypes of E. bieneusi in pigs in China remain poorly understood. The aim of this study was to determine the prevalence of E. bieneusi infection amongst pigs raised on farms from four cities of Hainan Province, using nested polymerase chain reaction (PCR) of the partial small subunit of the ribosomal RNA gene, and to identify genotypes of E. bieneusi isolates based on sequence analysis of the ribosomal internal transcribed spacer (ITS) region. Among 188 stool samples, E. bieneusi was detected in 46.8% (88/188). Eight genotypes including four known (EbpA, CS-4, MJ14, and CHG19) and four novel (HNP-I -HNP-IV) genotypes were identified. Using phylogenetic analysis, genotypes EbpA, CS4, CHG19, HNP-III, and HNP-IV were clustered into zoonotic Group 1, while the remaining three genotypes (MJ14, HNP-I, and HNP-II) clustered into Group 10. The high prevalence of zoonotic genotypes of E. bieneusi among pigs suggests that pig farming is a potential source of human infection. Additionally, this is the first identification of genotypes in Group 10 in pigs indicating unique epidemic features of E. bieneusi in pigs in Hainan Province, the southernmost part of China.

show abstract

“…; Mirjalali et al. , ). Taking into account the behavior of raccoons and their close association with human habitats, this animal may raise concerns about zoonotic transmission of microsporidia.…”

Section: Discussionmentioning

confidence: 98%

“…In order to characterize the genotypes, the ITS fragment of the rRNA gene of E. bieneusi was amplified using primers which were previously mentioned by Mirjalali et al. (). The first PCR employed EbGeno‐Fe (5′‐TTCAGATGGTCATAGGGATG‐3) and EbGeno‐Re (5‐ATTAGAGCATTCCGTGAGG‐3) as the forward and reverse primers, respectively, which together amplified a 465‐bp fragment of the ITS gene.…”

Section: Methodsmentioning

confidence: 99%

The First Report and Molecular Analysis of Enterocytozoon bieneusi from Raccoon (Procyon lotor) in North of Iran

Javanmard

Nemati

Sharifdini

et al. 2020

J Eukaryotic Microbiology

Self Cite

View full text Add to dashboard Cite

Microsporidia are known opportunistic microorganisms and usually transmitted via the fecal-oral route. However, there is no information about humaninfecting microsporidia in wildlife in Iran. This study aimed to investigate and analyze human-infecting microsporidia isolated from raccoons in north of Iran. Totally, 30 fecal samples were collected; then, DNA extraction was performed and specific fragments of the SSU rRNA gene of Enterocytozoon bieneusi and Encephalitozoon species were amplified. After amplification and sequencing the ITS, the results were compared to the GenBank database. Phylogenetic trees and network analysis were employed to explore probable relationships. E. bieneusi was the only detected microsporidia among samples. Genotyping showed the genotypes D, E, and RA in 15/18 (83.33%), 1/18 (5.55%), and 2/18 (11.11%) of samples, respectively. Novel genotypes RA1 and RA2 grouped together and apart from other genotypes. E. bieneusi genotypes D and E clustered with the genotypes previously reported from animals, humans, and environmental samples. Network analysis revealed six distinct sequence types among raccoon's isolates. This study demonstrated that E. bieneusi genotype D was the most prevalent microsporidia among raccoons. It seems that wildlife may play a role in dispersion of microsporidia spores.

show abstract

Genotyping and molecular analysis of Enterocytozoon bieneusi isolated from immunocompromised patients in Iran

Cited by 40 publications

References 37 publications

Molecular Diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. in Wild Rats of Southwest of Iran

Molecular Diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. in Wild Rats of Southwest of Iran

Molecular detection of Enterocytozoon bieneusi in farm-raised pigs in Hainan Province, China: infection rates, genotype distributions, and zoonotic potential

The First Report and Molecular Analysis of Enterocytozoon bieneusi from Raccoon (Procyon lotor) in North of Iran

Contact Info

Product

Resources

About