Geographical Patterns of nirS Gene Abundance and nirS-Type Denitrifying Bacterial Community Associated with Activated Sludge from Different Wastewater Treatment Plants

Abstract

Denitrifying bacteria is a driver of nitrogen removal process in wastewater treatment ecosystem. However, the geographical characteristics of denitrifying bacterial communities associated with activated sludge from diverse wastewater treatment plants (WWTPs) are still unclear. Here, quantitative PCR and next-generation sequencing of the nirS gene were applied to characterize the abundance and denitrifying bacterial communities from 18 geographically distributed WWTPs. The results showed that the nirS abundance ranged from 4.6 × 10 to 2.4 × 10 copies per ng DNA, while nirS-type denitrifying bacterial populations were diverse and distinct from activated sludge communities. Among WWTPs, total nitrogen removal efficiencies varied from 25.8 to 84%, which was positively correlated with diversity indices, whereas abundance-based coverage estimator index decreased with an increase in latitude. The dominant phyla across all samples were proteobacteria, accounting for 46.23% (ranging from 17.98 to 87.07%) of the sequences. Eight of the 22 genera detected were dominant: Thauera sp., Alicycliphilus sp., and Pseudomonas sp., etc. Based on network analysis, the coexistence and interaction between dominant genera may be vital for regulating the nitrogen and carbon removal behaviors. Multivariate statistical analysis revealed that both geographic location and wastewater factors concurrently govern the distribution patterns of nirS-type denitrifying bacterial community harbored in WWTPs. Taking together, these results from the present study provide novel insights into the nirS gene abundance and nirS-type denitrifying bacterial community composition in geographically distributed WWTPs. Moreover, the knowledge gained will improve the operation and management of WWTPs for nitrogen removal.

Alicycliphilus : current knowledge and potential for bioremediation of xenobiotics

“…) and in domestic and industrial wastewater treatment plants (Zhang et al . ) at several provinces in China, in microbial communities isolated from a watercourse contaminated with industrial discharges containing heavy metals that flows into Rio Negro, the largest affluent of the Amazon River (Brazil) (Veras Teles et al . ), and in diverse xenobiotics bioremediation systems that we will describe later.…”

“…) and Illumina‐sequencing of the functional nirS (nitrite reductase) gene (Zhang et al . ,b) have also been performed. Fluorescent in situ hybridization analyses have been performed with specific probes for the Comamonadacea family to see its spatial distribution in the sludge granules of an aerobic acetate‐denitrifying bacterial community, in which the Alicycliphilus presence was demonstrated by DGGE (Adav et al .…”

“…B1 was isolated from an activated sludge sample collected from the wastewater treatment plant of an electronic component factory (Japan) (Okutsu et al 2015). Alicycliphilus has been also detected in denitrifying bacterial communities present in distinct urban lakes (Zhang et al 2018a) and in domestic and industrial wastewater treatment plants (Zhang et al 2018b) at several provinces in China, in microbial communities isolated from a watercourse contaminated with industrial discharges containing heavy metals that flows into Rio Negro, the largest affluent of the Amazon River (Brazil) (Veras Teles et al 2018), and in diverse xenobiotics bioremediation systems that we will describe later.…”

Aryl hydrocarbon receptor regulates the expression of LmGSTd7 and is associated with chlorpyrifos susceptibility in Locusta migratoria

“…Total RNA extracted from ds GFP ‐ and ds LmAhR ‐injected specimens of L. migratoria was used for RNA Sequencing (RNA‐seq) library construction with three biological replicates. RNA‐seq library preparation methods used were as previously described . The six complementary DNA (cDNA) libraries were sequenced on an Illumina HiSeq 2000 platform with paired‐end 150‐bp reads (Illumina, San Diego, CA, USA).…”

Removing ammonium from underground water by strengthening Mn(III) generation through electrochemical reduction

“…To explore the microbial community composition in MnO x /AC, the Illumina Miseq Sequencing was performed according to reference (Zhang, Feng, et al., ; Zhang, Wang, et al., ; Zhou et al., ). In detail, DNA extracted from MnO x /AC was amplified by PCR using Primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 338R (5′‐TGCTGCCTCCCGTAGGAGT‐3′).…”