2019
DOI: 10.1007/s12639-019-01139-x
|View full text |Cite
|
Sign up to set email alerts
|

Giardia lamblia assemblages A and B isolated from symptomatic and asymptomatic persons in Hamadan, west of Iran

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
3
2

Citation Types

1
4
0

Year Published

2020
2020
2023
2023

Publication Types

Select...
7

Relationship

0
7

Authors

Journals

citations
Cited by 12 publications
(5 citation statements)
references
References 31 publications
1
4
0
Order By: Relevance
“…Several studies have described the relationships between assemblages and symptoms, but no clear association was demonstrated between the Giardia assemblage and clinical signs. Our results illustrated no significant association between Giardia assemblages and symptoms, in agreement with previous findings in Syria and Iran [ 27 , 50 , 51 ], whereas other studies found that assemblage A was considerably associated with symptoms in Egypt [ 31 ] and Iran [ 52 ]. Meanwhile, a study in Saudi Arabia revealed that clinical symptoms were strongly related with assemblage B [ 53 ].…”
Section: Discussionsupporting
confidence: 92%
See 1 more Smart Citation
“…Several studies have described the relationships between assemblages and symptoms, but no clear association was demonstrated between the Giardia assemblage and clinical signs. Our results illustrated no significant association between Giardia assemblages and symptoms, in agreement with previous findings in Syria and Iran [ 27 , 50 , 51 ], whereas other studies found that assemblage A was considerably associated with symptoms in Egypt [ 31 ] and Iran [ 52 ]. Meanwhile, a study in Saudi Arabia revealed that clinical symptoms were strongly related with assemblage B [ 53 ].…”
Section: Discussionsupporting
confidence: 92%
“…The G. intestinalis assemblage B human and cattle samples in the present study were asymptotic to those with the serial nos. KF843922.1 registered in Colombia [ 23 ], LC430549.1 registered in Zambia [ 24 ], AY228628.1 registered in Japan [ 49 ], and KY444789 registered in Iran [ 50 ]. This dimension of the phylogenetic analysis refers to the difference in the nitrogen base successions between the local sample of humans and cattle and those registered globally.…”
Section: Discussionmentioning
confidence: 99%
“…(2017) ; Jerez Puebla et al. (2017) ; Kashinahanji et al. (2019) Secondary: AL3544 Secondary: AL3545 CCCTTCATCGGIGGTAACTT GTGGCCACCACICCCGTGCC 532 Assemblage A-specific primers Af Ar CGCCGTACACCTGTCA AGCAATGACAACCTCCTTCC 332 (A) Assemblage B-specific primers Bf Br GTTGTTGTTGCTCCCTCCTTT CCGGCTCATAGGCAATTACA 400 (B) tpi Semi-nested PCR and sequencing Primary: tpi1f Primary: tpi479r CCCTTCATCGGYGGTAAC CCCGTGCCRATRGACCACAC A (AI, AII) & B (BIII, BIV) Breathnach et al.…”
Section: Molecular Tools For Genetic Characterisation Of G ...mentioning
confidence: 99%
“…Twenty-three samples were successfully genotyped ( n = 23) gdh, tpi Assemblage A (78%) Assemblage B (22%) No significant association was observed between assemblages and clinical manifestations. Kashinahanji et al. (2019) Malaysia Indigenous individuals living in village communities ( n = 42) SSU-rRNA Assemblage A (2%) Assemblage B (98%) Two times more likely to have diarrhoea, abdominal pain, vomiting and nausea with an assemblage B infection (OR = 2.4; P = 0.019).…”
Section: Molecular Tools For Genetic Characterisation Of G ...mentioning
confidence: 99%
“…To the best of our knowledge, this is the first study conducted on G. duodenalis -infected individuals in Tehran, Iran, using MLST. However, the overwhelming majority of studies in Iran have reported the molecular characterization of G. duodenalis isolates based on the analysis of one locus ( 21 – 26 , 42 , 43 ) or two loci of gdh and tpi ( 44 46 ) or gdh and bg ( 47 ). The MLG data was reported for two Giardia isolates in the only multilocus analysis in southwestern Iran ( 48 ).…”
Section: Discussionmentioning
confidence: 99%