Growth Hormone Inhibits Hepatic De Novo Lipogenesis in Adult Mice

Abstract

Patients with nonalcoholic fatty liver disease (NAFLD) are reported to have low growth hormone (GH) production and/or hepatic GH resistance. GH replacement can resolve the fatty liver condition in diet-induced obese rodents and in GH-deficient patients. However, it remains to be determined whether this inhibitory action of GH is due to direct regulation of hepatic lipid metabolism. Therefore, an adult-onset, hepatocyte-specific, GH receptor (GHR) knockdown (aLivGHRkd) mouse was developed to model hepatic GH resistance in humans that may occur after sexual maturation. Just 7 days after aLivGHRkd, hepatic de novo lipogenesis (DNL) was increased in male and female chow-fed mice, compared with GHR-intact littermate controls. However, hepatosteatosis developed only in male and ovariectomized female aLivGHRkd mice. The increase in DNL observed in aLivGHRkd mice was not associated with hyperactivation of the pathway by which insulin is classically considered to regulate DNL. However, glucokinase mRNA and protein levels as well as fructose-2,6-bisphosphate levels were increased in aLivGHRkd mice, suggesting that enhanced glycolysis drives DNL in the GH-resistant liver. These results demonstrate that hepatic GH actions normally serve to inhibit DNL, where loss of this inhibitory signal may explain, in part, the inappropriate increase in hepatic DNL observed in NAFLD patients.

Growth Hormone Control of Hepatic Lipid Metabolism

“…Notably, in the Li-GHRKO-HIT mice, SCD-1 index was reduced but not normalized, suggesting that GHR signaling directly suppresses hepatic DNL. These data are in agreement with previous study showing a twofold increase in DNL in GH-resistant mice (49). Overall, it is postulated that both lipid uptake and DNL occur in states of hepatic GH resistance independent of IGF-1.…”

Hepatocyte-specific, PPARγ-regulated mechanisms to promote steatosis in adult mice

“…In contrast to these reports, in the aLivPPARγkd model system, expression of DNL genes were not suppressed in any conditions tested, consistent with the lack of an effect on DNL indices (16:1/16:0 and 16:0/18:2). In fact, we have recently reported although PPARγ expression was associated with TAG accumulation in a model of DNL-generated steatosis (Kineman et al 2016), adult-onset hepatic PPARγ knockdown in this steatotic model did not reduce hepatic TAG content or FA indices of DNL (Cordoba-Chacon et al 2015a). The question arises, why are our current results counter to that previously reported by others?…”

“…DNA-free RNA was transcribed and qPCR performed as previously published (Cordoba-Chacon et al 2014a; Kineman et al 2016). qPCR primer sequences for PPARγ, carnitine palmitoyltransferase 1α (Cpt1α), adipose triglyceride lipase (Atgl), hormone-sensitive lipase (Hsl), sterol response element binding protein 1c (Srebp1c), acetyl-CoA carboxilase 1 (Acc1), fatty acid synthase (Fasn), fatty acid elongase (Elovl6), stearoyl –CoA desaturase 1 (Scd1), fatty acid translocase (Cd36), glycerol phosphate acyltransferase (Gpat1), monoacylglycerol acyltransferase 1 (Mogat1), Cre recombinase, GFP, Cyclophilin A, β-actin and Hypoxanthine-guanine phosphoribosyltransferase were previously published (Cordoba-Chacon et al 2014a; Cordoba-Chacon, et al 2015a; Kineman et al 2016). Primer sequences for: PPARα (NM_011144): Se: GGGAAAGACCAGCAACAACC, As: GCAGTGGAAGAATCGGACCT; acyl-CoA synthetase long-chain family member 1 (Acsl1, NM_007981): Se: GAGGGTGAGGTGTGTGTGAAA, As: CCGTGTGTAACCAGCCATCT; hepatic nuclear factor 4 α (Hnf4α, NM_008261.3): Se: ACATTCGGGCAAAGAAGATTG, As: ACCTGGTCATCCAGAAGGAGTT; PPARγ co-activator 1 α; (Pgc1α, NM_008904.2): Se: TTCCCGATCACCATATTCCA, As: TTCATCCCTCTTGAGCCTTTC; Cyp4a10 (NM_010011.3): Se: CCACTGATTCTGTTGTGGAGC, As: CATTAGAAGAGAGGGGATGAGGA; monoacylglycerol lipase (Mgll, NM_001166251.1): Se: GTGGAATGCAAAAGCCAAGA, As: AGCTCATCATAACGGCCACA; apolipoprotein B (ApoB, NM_009693.2): Se: AGCCCAGCACTGACTGACTT, As: GAAGCCTTGGGCACATTG; microsomal triglyceride transfer protein (Mttp, NM_001163457.1): Se: CAGTGGATGCCTCTTTTGTG, As: GTCTCGAATTGCCTGAGTGG; hepatic lipase (Hl, NM_008280.2): Se: TTTTCCTGGTGTTCTGCATCT, As: CAGGCGATCGTTTTCATCTT; low density lipoprotein lipase receptor (Ldlr, NM_001252658.1): Se: TGTCACCTGTCAGTCCAATCAA, As: TCAGAGCCATCTAGGCAATCTC; very-low density lipoprotein receptor (Vldlr, NM_013703.2): Se: GTGCAAGGCAGTAGGCAAAG, As: GCTGAGATCAGCCCAAAACA; lipoprotein related protein 1 (Lrp1, NM_008512.2): Se: ACACACGCCAACTGTACCAA, As: TGACATTCGGGTCACAAACA; monoacylglycerol acyltransferase 2 (Mogat2, NM_146035.2): Se: TGTGAAAACTTGGAAATCGACA, As: CAGTCTCCAGCATGAAAAATCC; diacylglycerol acyltransferase 1 (Dgat1, NM_010046.2): Se: AGCTGTGGCCTTACTGGTTG, As: AGCAGCCCCACTGACCTT.…”

MECHANISMS IN ENDOCRINOLOGY: Lessons from growth hormone receptor gene-disrupted mice: are there benefits of endocrine defects?

“…An adult-onset hepatocyte-specific GHR knockdown (aLivGHRkd) mouse model was developed through injection at 10-to 12-weeks-age with adeno-associated virus (AAV) bearing a liver-specific thyroxine-binding globulin (TBG) promoter driving a Crerecombinase transgene (299). Seven days after the injection, hepatic de novo lipogenesis significantly increased and hepatosteatosis developed in male mice and ovariectomized female mice suggesting that hepatic GH actions normally serve to inhibit de novo lipogenesis in the livers.…”