Hemin/G-quadruplex-based DNAzyme concatamers for in situ amplified impedimetric sensing of copper(II) ion coupling with DNAzyme-catalyzed precipitation strategy

Xu, Mingdi; Gao, Zhuangqiang; Wei, Qing; Chen, Guonan; Tang, Dianping

doi:10.1016/j.bios.2015.05.056

Cited by 85 publications

(27 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“… Target Sequence Detection method Limit of Detection Linear detection range Ref. Hg 2+ 5’-HS-(CH 2 ) 6 -TTTGGGTAGGGCGGGTTGGG-3’ Surface plasmon resonance 20 nmol/L 20–200 nmol/L Pelossof et al (2011) Pb 2+ 5′-TCATGGGTGGGTGGGTGGGTGA–NH 2 –3′ Electrochemistry 3.6 × 10 −14 mol/L 1 × 10 −13 –5 × 10 −11 mol/L Deng et al (2016) Cu 2+ – Electrochemistry 60 fM 0.1pM–5.0 nM Xu et al (2015) cholesterol 5′-GTGGGTAGGGCGGGTTGG-3′ Colorimetry 1–30 μmol/L 0.10 μmol/L Li et al (2012) HBV 5′–HS–(CH 2 ) 6 –TTTCCCTACCCTTGGTGGGCGTTCACGGTGGTCTCTTTGGGTAGGGCGGGTTGGG-3′ Electrochemistry 0.5 pM 10 pM-10 nM Shi et al (2015) S1 nuclease 5′-GGGAAAGGGAAAGGGAAAGGG-3′ Colorimetry 5.2 × 10 −2 U/mL 1 × 10 −1 –1 U/mL Wang et al (2015a) thrombin 5′-GGTTGGTGTGGTTGG-3′ Colorimetry 15 fM 0.05 pM–60 nM Chen et al (2016) H 2 O 2 5′-GGTGGTGGTGGTTGTGGTGGTGGTGG-3′ …”

Section: G-quadruplex Based Biosensormentioning

confidence: 99%

“…The formation of G-quadruplex structure for improved sensitivity of the sensor was also successfully used for the detection of other metal ions, such as Sr 2+ , Hg 2+ and Cu 2+ with detection limit as low as nM level ( Pelossof et al, 2011 ; Kong et al, 2010a ; Huang et al, 2019 ). Xu et al (2015) designed a DNA enzyme binding agent based on heme/G-tetramer, which was used as an in-situ amplification impedance sensor coupled with copper (II) ion and DNA enzyme. The relative standard deviation (RSD) was 8.5% and 9.1% for the same and different batches of sensors, respectively.…”

Section: G-quadruplex Based Biosensormentioning

confidence: 99%

See 1 more Smart Citation

G-quadruplex based biosensor: A potential tool for SARS-CoV-2 detection

Juhas

Zhang

2020

Biosensors and Bioelectronics

View full text Add to dashboard Cite

G-quadruplex is a non-canonical nucleic acid structure formed by the folding of guanine rich DNA or RNA. The conformation and function of G-quadruplex are determined by a number of factors, including the number and polarity of nucleotide strands, the type of cations and the binding targets. Recent studies led to the discovery of additional advantageous attributes of G-quadruplex with the potential to be used in novel biosensors, such as improved ligand binding and unique folding properties. G-quadruplex based biosensor can detect various substances, such as metal ions, organic macromolecules, proteins and nucleic acids with improved affinity and specificity compared to standard biosensors. The recently developed G-quadruplex based biosensors include electrochemical and optical biosensors. A novel G-quadruplex based biosensors also show better performance and broader applications in the detection of a wide spectrum of pathogens, including SARS-CoV-2, the causative agent of COVID-19 disease. This review highlights the latest developments in the field of G-quadruplex based biosensors, with particular focus on the G-quadruplex sequences and recent applications and the potential of G-quadruplex based biosensors in SARS-CoV-2 detection.

show abstract

Section: G-quadruplex Based Biosensormentioning

confidence: 99%

Section: G-quadruplex Based Biosensormentioning

confidence: 99%

G-quadruplex based biosensor: A potential tool for SARS-CoV-2 detection

Juhas

Zhang

2020

Biosensors and Bioelectronics

View full text Add to dashboard Cite

show abstract

“…Recently, two types of DNAzyme have been a hot topic of research. One type of DNAzyme is G-quadruplex-based DNAzyme, which possesses mimic-horse radish peroxidase (HRP) activity to catalyze specific substrate for chromogenic reaction1516171819. The other type is metal ion-dependent DNAzyme, Which could depend on specific metal ions as cofactors, such as Ag + ions20, Na + ions2122, Cu 2+ ions232425, Pb 2+ ions2627, Mg 2+ ions28, Zn 2+ ions2930, Ca 2+ ions3132, Cd 2+ ions33, UO 2 2+ ions, Hg 2+ ions3435, and lanthanide ions363738.…”

mentioning

confidence: 99%

A rapid and visual turn-off sensor for detecting copper (II) ion based on DNAzyme coupled with HCR-based HRP concatemers

Tian

Luo

et al. 2017

Sci Rep

View full text Add to dashboard Cite

To solve the requirement of on-site, rapid, and visual detection of copper (II) (Cu2+) in aqueous solution, a turn-off sensor for detecting copper (II) ion was developed based on Cu2+-dependent DNAzyme as the recognition element and hybridization chain reaction (HCR)-based horseradish peroxidase (HRP) concatemers as the signal amplifier and the signal report element. The detection unit, which was composed of the immobilized Cu2+-dependent DNAzyme coupled with HCR-based HRP concatemers via Waston-Crick base pairing, could catalyze hydrogen peroxide (H2O2) via TMB, generating obvious green color and turning yellow after sulfuric acid termination with optical absorption at 450 nm. Upon Cu2+ addition, the substrate strand of the Cu2+-dependent DNAzyme concatenated with the HCR-based HRP complex was irreversibly cleaved, efficiently causing dramatic reduction of the detection signal. Under optimal conditions, the detection signal decreased with the concentration of Cu2+ in 5 min, exhibiting a linear calibration from 0.05 to 3 μM with a detection limit of 8 nM. The sensor also displayed a high selectivity for Cu2+ given the specificity and anti-interference of the detection unit, and this system was applicable for monitoring Cu2+ in real water samples. Generally speaking, the proposed sensor exhibits good potential in environment surveys.

show abstract

“…By designing the HP sequences to contain Gq, HCR-based concatamers with tandem hemin/Gq complexes were able to achieve ultrasensitive detection. 21,24,35,39 4. Targeting strategy…”

Section: Concatamersmentioning

confidence: 99%

Hemin/G-quadruplex Complex as a Signal Generator for Electrochemical Assays of Bioanalytes

Funabashi

2016

Electrochemistry

View full text Add to dashboard Cite

Single-stranded deoxyribonucleic acid (ssDNA) with guanine-rich sequences can form four-stranded structures so called G-quadruplex (Gq), which binds hemin, an iron-containing porphyrin. The hemin/Gq is an electroactive complex and exhibits peroxidase activity, and thus the hemin/Gq complexes have attracted great attention as a signal generator. This short review surveys the use of the hemin/Gq complex as an electrochemical signal generator. Electrochemical methods for detecting the hemin/Gq complex, approaches to signal amplification, and targeting strategies are herein discussed. Compared with protein-based signal generators, hemin/Gq complexes have some advantages: a wide variety of ssDNA sequences with various chemical modifications are easy to obtain, they can be immobilized on an electrode easily, and they can be designed as desired to connect functional domains. Also there are many molecular-biological tools to handle them. Hemin/Gq complexes have been successfully used to detect bioanalytes ranging from low molecular weight compound to macromolecules such as proteins, specific nucleic acids, or living cancer cells. Such bioanalytes are critical to the investigation of cellular function. Thus, DNAbased probes that contain hemin/Gq as a signal generator are a promising tool for the electrochemical analysis of cellular function, offering a competent alternative to a conventional protein-based signal generator.

show abstract

Hemin/G-quadruplex-based DNAzyme concatamers for in situ amplified impedimetric sensing of copper(II) ion coupling with DNAzyme-catalyzed precipitation strategy

Cited by 85 publications

References 34 publications

G-quadruplex based biosensor: A potential tool for SARS-CoV-2 detection

G-quadruplex based biosensor: A potential tool for SARS-CoV-2 detection

A rapid and visual turn-off sensor for detecting copper (II) ion based on DNAzyme coupled with HCR-based HRP concatemers

Hemin/G-quadruplex Complex as a Signal Generator for Electrochemical Assays of Bioanalytes

Contact Info

Product

Resources

About