Heritable Glycogen-storage Deficiency in Yeast and its Induction by Ultra-violet Light

Chester, V. E.

doi:10.1099/00221287-51-1-49

Cited by 92 publications

(55 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Protein concentrations were determined by the procedure of Bradford (5), with bovine serum albumin as a standard. Qualitative glycogen assays were performed by inverting colonies growing on petri dishes over iodine vapor as previously described (15).…”

Section: Methodsmentioning

confidence: 99%

The REG2 Gene of Saccharomyces cerevisiae Encodes a Type 1 Protein Phosphatase-Binding Protein That Functions with Reg1p and the Snf1 Protein Kinase to Regulate Growth

Frederick

Tatchell

1996

Molecular and Cellular Biology

View full text Add to dashboard Cite

The GLC7 gene of Saccharomyces cerevisiae encodes the catalytic subunit of type 1 protein phosphatase (PP1) and is essential for cell growth. We have isolated a previously uncharacterized gene, REG2, on the basis of its ability to interact with Glc7p in the two-hybrid system. Reg2p interacts with Glc7p in vivo, and epitope-tagged derivatives of Reg2p and Glc7p coimmunoprecipitate from cell extracts. The predicted protein product of the REG2 gene is similar to Reg1p, a protein believed to direct PP1 activity in the glucose repression pathway. Mutants with a deletion of reg1 display a mild slow-growth defect, while reg2 mutants exhibit a wild-type phenotype. However, mutants with deletions of both reg1 and reg2 exhibit a severe growth defect. Overexpression of REG2 complements the slow-growth defect of a reg1 mutant but does not complement defects in glycogen accumulation or glucose repression, two traits also associated with a reg1 deletion. These results indicate that REG1 has a unique role in the glucose repression pathway but acts together with REG2 to regulate some as yet uncharacterized function important for growth. The growth defect of a reg1 reg2 double mutant is alleviated by a loss-of-function mutation in the SNF1-encoded protein kinase. The snf1 mutation also suppresses the glucose repression defects of reg1. Together, our data are consistent with a model in which Reg1p and Reg2p control the activity of PP1 toward substrates that are phosphorylated by the Snf1p kinase.The reversible phosphorylation of proteins has long been recognized as a widespread mechanism of posttranslational regulation among eukaryotes. The phosphorylation state of a given protein is dependent on the relative activities of protein kinases and protein phosphatases. Early biochemical studies suggested that protein phosphatases might represent a much smaller group of enzymes than protein kinases. Whereas most kinases recognize specific motifs of five or six amino acids (46), phosphatases generally exhibit a fairly broad substrate specificity (17,64). These data contributed to the idea that cellular signaling responses were largely determined by the activities of specific protein kinases whereas phosphatases functioned at a low constitutive level (64). Recent advances have underscored the importance of protein phosphatases in controlling physiological processes and have demonstrated that protein phosphatases are in fact highly regulated.The serine/threonine protein phosphatases are among the most conserved proteins throughout evolution. The type 1 protein phosphatase (PP1) is Ͼ80% identical in mammals and in yeasts (24, 55) and has been demonstrated to play key roles in a variety of cellular processes. In mammalian cells, PP1 regulates glycogen metabolism, muscle contractility, and protein synthesis (4, 17, 64) and has been shown to interact with the product of the retinoblastoma tumor suppressor gene (20). Studies of S. cerevisiae have likewise demonstrated multiple physiological roles for PP1, including glycogen metabolism (10, 24)...

show abstract

Section: Methodsmentioning

confidence: 99%

The REG2 Gene of Saccharomyces cerevisiae Encodes a Type 1 Protein Phosphatase-Binding Protein That Functions with Reg1p and the Snf1 Protein Kinase to Regulate Growth

Frederick

Tatchell

1996

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…The construction of the ras and bcy mutants was described previously (Pichova et al, 1997;Hlavata et al, 2003). To exclude artifacts because of spontaneous suppressor mutations during experiments with cells carrying the RAS2 val19 or bcy1 allele, we systematically stained colonies for glycogen content (Chester, 1968;Toda et al, 1985) after each experiment. The plasmid Yep13 carrying the PDE2 gene was kindly provided by A. Pichová (Institute of Microbiology, Prague).…”

Section: Experimental Procedures Yeast Strains Plasmids and Growth mentioning

confidence: 99%

Elevated Ras/protein kinase A activity in Saccharomyces cerevisiae reduces proliferation rate and lifespan by two different reactive oxygen species‐dependent routes

et al. 2007

View full text Add to dashboard Cite

“…Qualitative glycogen assays were performed by using iodine vapors as previously described (14). Quantitative glycogen assays were performed as previously described (30,31 To examine expression of the epitope-tagged proteins, cell extracts were compared by immunoblot analysis from strains harboring the low-copy-number myc-GLC7 plasmid or from strains harboring either low-or high-copy-number of this band is significantly greater than the 89.3-kDa predicted molecular mass deduced from the nucleotide sequence.…”

mentioning

confidence: 99%

The mutant type 1 protein phosphatase encoded by glc7-1 from Saccharomyces cerevisiae fails to interact productively with the GAC1-encoded regulatory subunit.

Stuart¹,

Frederick²,

Varner³

et al. 1994

Mol. Cell. Biol.

View full text Add to dashboard Cite

Loss-of-function gac mutants of Saccharomyces cerevisiae fail to accumulate normal levels of glycogen because of low glycogen synthase activity. Increased dosage of GACI results in increased activity of glycogen synthase and a corresponding hyperaccumulation of glycogen. The glycogen accumulation phenotype ofgacl is similar to that ofglc7-1, a type 1 protein phosphatase mutant. We have partially characterized the GACI gene product (Gaclp) and show that levels of Gaclp increase during growth with the same kinetics as glycogen accumulation. Gaclp is phosphorylated in vivo and is hyperphosphorylated in a gkc7-1 mutant. Gaclp and the type 1 protein phosphatase directly interact in vitro, as assayed by coimmunoprecipitation, and in vivo, as determined by the dihybrid assay described elsewhere (S. Fields and O.-k. Song, Nature [London] 340:245-246, 1989). The interaction between Gaclp and the glc7-1-encoded form of the type 1 protein phosphatase is defective, as assayed by either immunoprecipitation or the dihybrid assay. Increased dosage of GACI partially suppresses the glycogen defect of gkc7-1. Collectively, our data support the hypotheses that GACI encodes a regulatory subunit of type 1 protein phosphatase and that the glycogen accumulation defect of gkc7-1 is due at least in part to the inability of the mutant phosphatase to interact with its regulatory subunit.Protein phosphorylation is an almost universal mechanism of posttranslational regulation. In eukaryotes, the transfer of phosphate to serine, threonine, and tyrosine residues is carried out by a conserved family of protein kinases. The large number of protein kinases in the cell (37) The Myc tag was introduced into GACI between the second and third codon by using PCR (55) with one oligonucleotide that contained the Myc tag flanked by GACI sequence (5'-GCTLAAACCATCGTAGAACAAAAGCTTA T`ITCTGAAGACTTGATACAAACTGCT-3') and a second oligonucleotide (5'-ATTACTATCACTATCTTCG-3') containing GACI sequence. The PCR product was digested with NcoI and SstI, and the 1.6-kb GACI fragment that contained the Myc epitope was used to replace the NcoI-SstI fragment of pJS-26 or pJS-34 to create the full-length Myc-tagged GACI clone (pJS-33) or truncated GACI clone (pJS-36), respectively. The constructions were confirmed by sequence analysis. The full-length (pJS-38) and versions of the Myc-tagged GACI were ligated into the low-copy-number pUN100 vector as BamHI-SalI and SphISstI fragments, respectively.Since GLC7 is an essential gene, we introduced the epitope-tagged GLC7 genes into yeast cells by transforming a diploid strain (JS12) heterozygous for aglc7::HIS3 disruption with a YCpSO-based plasmid carrying either the Myc-or the Ha-tagged GLC7 genes or the wild-type GLC7 gene. The transformants were subjected to tetrad analysis, and spore clones that contained the glc7::HIS3 gene disruption and one of the GLC7-containing plasmids were recovered. The pep4Al mutation was introduced into this background by additional crosses.The glc7-1 mutation was transferred into the YCp5O-Ha-G...

show abstract

Heritable Glycogen-storage Deficiency in Yeast and its Induction by Ultra-violet Light

Cited by 92 publications

References 13 publications

The REG2 Gene of Saccharomyces cerevisiae Encodes a Type 1 Protein Phosphatase-Binding Protein That Functions with Reg1p and the Snf1 Protein Kinase to Regulate Growth

The REG2 Gene of Saccharomyces cerevisiae Encodes a Type 1 Protein Phosphatase-Binding Protein That Functions with Reg1p and the Snf1 Protein Kinase to Regulate Growth

Elevated Ras/protein kinase A activity in Saccharomyces cerevisiae reduces proliferation rate and lifespan by two different reactive oxygen species‐dependent routes

The mutant type 1 protein phosphatase encoded by glc7-1 from Saccharomyces cerevisiae fails to interact productively with the GAC1-encoded regulatory subunit.

Contact Info

Product

Resources

About