Heterologous expression and optimization using experimental designs allowed highly efficient production of the PHY US417 phytase in Bacillus subtilis 168

Abstract

To attempt cost-effective production of US417 phytase in Bacillus subtilis, we developed an efficient system for its large-scale production in the generally recognized as safe microorganism B. subtilis 168. Hence, the phy US417 corresponding gene was cloned in the pMSP3535 vector, and for the first time for a plasmid carrying the pAMβ1 replication origin, multimeric forms of the resulting plasmid were used to transform naturally competent B. subtilis 168 cells. Subsequently, a sequential optimization strategy based on Plackett-Burman and Box-Behnken experimental designs was applied to enhance phytase production by the recombinant Bacillus. The maximum phytase activity of 47 U ml-1 was reached in the presence of 12.5 g l-1 of yeast extract and 15 g l-1 of ammonium sulphate with shaking at 300 rpm. This is 73 fold higher than the activity produced by the native US417 strain before optimization. Characterization of the produced recombinant phytase has revealed that the enzyme exhibited improved thermostability compared to the wild type PHY US417 phytase strengthening its potential for application as feed supplement. Together, our findings strongly suggest that the strategy herein developed combining heterologous expression using a cloning vector carrying the pAMβ1 replication origin and experimental designs optimization can be generalized for recombinant proteins production in Bacillus.

Characterization of an extremely salt-tolerant and thermostable phytase from Bacillus amyloliquefaciens US573

“…1) shows that the exponential growth phase was accompanied with an increase in phytase activity. From 54 h, we note a decline phase in which bacterial growth ceases, but the enzyme secretion continues to increase reaching its maximum value of 2.76 U/ml after a cultivation period of 110 h. The lag observed between maximal growth and highest extracellular phytase production levels can be explained to some extent by the time needed for complete functional recognition and processing of the signal peptide of the phytase precursor by the bacterial secretion machinery as suggested in [18]. The maximal level of phytase production attained by the US573 isolate was comparable to that of Bacillus laevolacticus (2.9 U/ml), but higher than the values of 0.64 and 0.40 U/ml corresponding to phytase production by B. subtilis US417 and B. subtilis VTTE 68013, respectively [25,27,28].…”

“…The isolates developing the largest clear zones around were further screened on optimized liquid wheat bran medium [18] to confirm their ability to produce extracellular phytase activity. The selected isolate, namely US573 comes out as the most efficient phytase producer.…”

“…Colonies with dissimilar morphological aspect were picked up individually, further purified by streaking and then, screened for their ability to produce phytase on LB agar supplemented with phytic acid at 3 mM by using the two step counterstaining treatment as described in [17]. The isolates developing clear phytic acid hydrolysis zones around were further screened on the optimized liquid wheat bran medium as described in [18]. Cultures were carried out in 500 ml flasks containing 100 ml of medium, inoculated at 0.1 OD 600 from 19 h-old culture grown on LB and incubated at 37 • C for 72 h under shaking conditions of 250 rpm.…”

“…PCR amplification of the 16S rRNA gene (PCR 1) and the 16S-23S intergenic region (PCR 2) from the US573 strain were performed using primers corresponding to highly conserved regions within the rRNA operon of E. coli (Oligonucleotide l: 5 AGAGTTTGATCCTGGCTCAG3 and Oligonucleotide 2: 5 AAGGAGGTGATCCAAGCC3 for PCR 1; Oligonucleotide 3: 5 GGCTTGGATCACCTCCTCCTT3 and Oligonucleotide 4: 5 ACTTAGATGTTTCAGTTC3 for PCR 2) [19]. Amplification conditions were 30 cycles of 30 s at 94 • C, 60 s at 65 • C and 90 s at 72 • C for PCR 1 and 30 cycles of 30 s at 94 • C, 60 s at 52 • C and 60 s at 72 • C for PCR 2.…”

“…Phytase was produced after cultivation of the B. amyloliquefaciens US573 strain in the optimized wheat bran medium as described in [18], for 110 h at 37 • C. The extracellular phytase activity was recovered by centrifugation (8000 rpm, 20 min). This crude supernatant was heat treated (90 • C for 2 min) followed by centrifugation at 15,000 rpm for 20 min at 4 • C. Proteins were precipitated between 65 and 85% ammonium sulphate, suspended in 0.1 M Tris-HCl buffer pH 7.5 and dialysed for 48 h. The degree of homogeneity of the purified enzyme was judged by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining as described in [24] 2.9.…”