High CHI3L1 expression is associated with glioma patient survival

Abstract

BackgroundSurvival of glioma patients with the same tumor histology and grade can vary significantly, and some low-grade gliomas transform to a more malignant phenotype. There is a need of molecular signatures, which are better predictors of the patient diagnosis, outcome of treatment, and prognosis than the diagnosis provided by histopathology. We propose CHI3L1 mRNA expression as a prognostic biomarker for patients with glioma.MethodsWe measured CHI3L1 expression with quantitative real time-polymerase chain reaction (qRT-PCR) in the cohort of 98 patients with different grade glioma: 10 grade I pylocytic astrocytomas, 30 grade II diffuse astrocytomas, 20 grade III anaplastic astrocytomas, and 38 grade IV astrocytomas (glioblastomas). Statistical analyses were conducted to investigate the association between CHI3L1 mRNA expression levels and patient clinical variables.ResultsWe demonstrated that mRNA expression of CHI3L1 was evidently higher in glioblastoma than in lower grade glioma tissues. We evaluated correlations between CHI3L1 expression, clinicopathological characteristics, and the outcomes of the patients. Patients with high CHI3L1 expression had a shorter overall survival (p < 0.001).ConclusionsFindings presented in our study showed that increased mRNA level of CHI3L1 could be associated with the progression of astrocytoma and poor patient survival not only for glioblastoma, but for lower grade astrocytoma tumors as well. Further investigation will be required to evaluate CHI3L1 value as a molecular marker for astrocytoma prognoses and for novel treatment strategies against all grade astrocytomas.

PPIC, EMP3 and CHI3L1 Are Novel Prognostic Markers for High Grade Glioma

“…A wealth of clinical evidence has revealed that elevated serum levels of CHI3L1 in GBM are positively correlated with cancer invasiveness, radioresistance, recurrence, and reduced patient survival times [37,38]. There are data that suggest that CHI3L1 expression could be a prognostic predictor of glioblastoma [39,40,41]. This is the same as what we found.…”

OSgbm: An Online Consensus Survival Analysis Web Server for Glioblastoma

“…To determine the performance of this online tool, 53 previously published GBM prognostic factors collected as the procedure shown in Figure S1 and then they were evaluated in OSgbm (Table 2, Figure 1) (Sano et al, 1999;Hung and Howng, 2003;Heimberger et al, 2005;Aaberg-Jessen et al, 2009;Shirai et al, 2009;Pu et al, 2011;Cui et al, 2013;De Tayrac et al, 2013;Lee et al, 2013;Rosati et al, 2013;Wang et al, 2013;Wu et al, 2013;Bai et al, 2014;Han et al, 2014;Meng et al, 2014;Olmez et al, 2014;Zupancic et al, 2014;Maris et al, 2015;Moutal et al, 2015;Yan et al, 2015;Zhao et al, 2015;Chaurasia et al, 2016;Nduom et al, 2016;Steponaitis et al, 2016;Steponaitis et al, 2016;Zhang et al, 2016a;Zhang et al, 2016b;Deng et al, 2017;Dong et al, 2017;Ge et al, 2017;Han et al, 2017;Haynes et al, 2017;Huang et al, 2017;Li et al, 2017;Luo and Zhuang, 2017;Ma et al, 2017;Roy et al, 2017;Wu et al, 2017;Zhang et al, 2017;…”

Knockdown of PARP6 or survivin promotes cell apoptosis and inhibits cell invasion of colorectal adenocarcinoma cells

“…After six days of transfection, total RNA was isolated and the transcription levels of PARP6 and survivin were determined by real-time reverse transcriptase polymerase chain reaction (25). The primer pairs were: TTTGAGCCTTATCCC TCTGTG (sense) and TGGGTCATCTCCCGAATAGA (antisense) for PARP6; TTTGAGGAAACTGCGGAGAA (sense) and GGTGGCACCAGGGAATAAA (antisense) for survivin; and primers for β-actin ATCGTGCGTGACATTAAGG AGAAG (sense) and AGGAAGGAAGGCTGGAAGAGTG (antisense).…”

“…The primer pairs were: TTTGAGCCTTATCCC TCTGTG (sense) and TGGGTCATCTCCCGAATAGA (antisense) for PARP6; TTTGAGGAAACTGCGGAGAA (sense) and GGTGGCACCAGGGAATAAA (antisense) for survivin; and primers for β-actin ATCGTGCGTGACATTAAGG AGAAG (sense) and AGGAAGGAAGGCTGGAAGAGTG (antisense). The final result was expressed as log2 of 2 -ΔCT calculation, and the levels of mRNA were normalized to β-actin (25).…”