High‐efficiency protein expression mediated by enterovirus 71 internal ribosome entry site

Lee, Jin‐Ching; Wu, Tzong Yuan; Huang, Chien Fu; Yang, Feng-Ming; Shih, Shin Ru; Hsu, John

doi:10.1002/bit.20440

Cited by 21 publications

(20 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The HEV71 genome is uncapped and viral protein translation is initiated via an IRES [82]. The secondary structure of the IRES is essential for translation, and the IRES is thought to interact with the 40S ribosomal subunit either directly or via host cell factors [82][83][84].…”

Section: Viral Protein Translationmentioning

confidence: 99%

Recent Advances in Research on Human Enterovirus 71

Bek

McMinn²

2010

Future Virol.

View full text Add to dashboard Cite

Over the past decade, Human enterovirus (HEV)71 has emerged as a highly significant cause of viral encephalitis in the south-east Asian region. A pattern of increased epidemic activity has been observable since 1997, the cause of which is unclear. Ongoing investigations into the molecular basis of HEV71 infection and virulence, in particular viral translation and replication, have confirmed similarities between HEV71 and other enteroviruses, including the prototype species Poliovirus, but more work is required in this field. Although several putative receptors for HEV71 have been identified, it remains likely that other, as yet unidentified, receptors exist. Work in several established animal models for HEV71 infection has confirmed the protective efficacy of several inactivated vaccines. As more information emerges regarding the molecular processes involved in HEV71 infection, further advances may lead to the development of more effective antiviral treatments and, ultimately, a vaccine protection strategy.

show abstract

Section: Viral Protein Translationmentioning

confidence: 99%

Recent Advances in Research on Human Enterovirus 71

Bek

McMinn²

2010

Future Virol.

View full text Add to dashboard Cite

show abstract

“…We generated the plasmids pGS-EV71 and pGS-EMCV as described by Lee et al [19] . These contained IRES elements derived from EV71 and EMCV, respectively, flanked by the β-galactosidase as well as secreted alkaline phosphatase (SEAP) reporter genes.…”

Section: Methodsmentioning

confidence: 99%

“…However, EMCV IRES-mediated translation is less efficient than the cap-dependent translation of the upstream gene [17,18] . We have previously reported a potent IRES derived from the picornavirus Enterovirus 71 (EV71) and demonstrated the EV71 IRES translation efficiency to be approximately 10-to 15-fold higher than that of EMCV IRES in cell lines [19] . In this study, we identified amantadine, a compound that inhibited EV71 IRES as well as EMCV IRES-mediated translation but did not interfere with cap-dependent translation.…”

Section: Introductionmentioning

confidence: 99%

Amantadine as a regulator of internal ribosome entry site

et al. 2008

Self Cite

View full text Add to dashboard Cite

Aim: Studies of eukaryotes have yielded 2 translation initiation mechanisms: a classical cap-dependent mechanism and a cap-independent mechanism proceeding through the internal ribosomal entry site (IRES). We hypothesized that it might be possible to identify compounds that may distinguish between cap-dependent translation and cap-independent IRES-mediated translation. Methods: To facilitate compound screening, we developed bicistronic reporter constructs containing a β-galactosidase gene (β-gal) and a secreted human placental alkaline phosphatase (SEAP) reporter gene. Following transcription, the β-gal gene is translated by a cap-dependent mechanism, while SEAP expression is controlled by the IRES derived from either enterovirus 71 (EV-71) or encephalomyocarditis virus (EMCV). This assay could potentially identify compounds that inhibit SEAP expression (cap-independent) without affecting β-gal activity (cap-dependent). Results: Using a bicistronic plasmid-based transient transfection assay in the COS-1 cells, we identified amantadine, a compound that inhibited the IRES of EV71-and EMCV-mediated cap-independent translation but did not interfere with cap-dependent translation when the dose of amantadine was lower than 0.25 mg/mL. Conclusion: These results imply that amantadine may distinguish between cap-dependent translation and cap-independent IRES-mediated translation and can be used to regulate gene expression at a translational level.

show abstract

“…The SEAP gene was then inframed-fused with the EGFP gene in the pBacDRhirE plasmid. Briefly, the SEAP gene fragment was first amplified from the pGS-HCV plasmid (Lee et al 2005) by polymerase chain reaction (PCR) with the forward primer, 5¢-AT ATAAGATCTCCACCATGCTGCTGCTGTG CTGCTGCTGGG-3¢ (with the BalII site underlined), and the reverse primer, 5¢-AATTCAG ATCTGGTGTCTGCTCGAAGCGGCCGGC-3¢ (with the BalII site underlined). Two GG nucleotides in the reverse primer (bold and italicized) were added to allow the in-frame fusion between the 3¢ end of the SEAP and the 5¢ end of the EGFP gene.…”

Section: Construction Of Plasmid Transfer Vectorsmentioning

confidence: 99%

Secretory fluorescent protein, a secretion green fluorescent fusion protein with alkaline phosphatase activity as a sensitive and traceable reporter in baculovirus expression system

Teng

2007

Biotechnol Lett

Self Cite

View full text Add to dashboard Cite

The advantages of using traceable fluorescent protein (enhanced green fluorescent protein; EGFP) and a secretory alkaline phosphatase (SEAP) have been used to generate a reporter gene: the secretory fluorescent protein (SEFP). Sf21 cells, infected with the recombinant baculovirus containing the SEFP gene, revealed both traceable fluorescence and easily detectable alkaline phosphatase activity in the culture medium. The distribution of SEFP within the cells revealed that it was excluded from the nucleus, implying that the accumulation of SEFP in a secretory pathway, similar to that of the secretion signal-tagged FPs. Furthermore, the time- and dose-dependent release from the blockage of brefeldin A (BFA) confirmed that the secretion of SEFP was mediated by the secretion pathway and excluded leakage from viral infection. This SEFP reporter gene with traceable fluorescence and alkaline phosphatase activity may become a useful tool for studies on secretory protein production.

show abstract

High‐efficiency protein expression mediated by enterovirus 71 internal ribosome entry site

Cited by 21 publications

References 34 publications

Recent Advances in Research on Human Enterovirus 71

Recent Advances in Research on Human Enterovirus 71

Amantadine as a regulator of internal ribosome entry site

Secretory fluorescent protein, a secretion green fluorescent fusion protein with alkaline phosphatase activity as a sensitive and traceable reporter in baculovirus expression system

Contact Info

Product

Resources

About