High throughput analysis of vacuolar acidification

The interdependent transport of yeast vacuole Ca2+ and H+ and the role of phosphatidylinositol 3,5-bisphosphate

“…First, we used vph1 Δ vacuoles in the AO fluorescence assay to verify that the deletion indeed inhibited vacuole acidification. We observed that AO fluorescence at 520 nm was not affected when using vph1 Δ vacuoles, indicating that V-ATPase was blocked as shown previously ( 41 ) ( Fig. 10 , A and B ).…”

“…2 , C and D ). We have also used the PI4P binding PH domain from FAPP1 at concentrations that inhibit vacuole fusion and saw no effect on acidification ( 41 , 42 , 43 , 44 ). This underscores the importance of free PI(3,5)P 2 in vacuole acidification.…”

“…We should note that bafilomycin inhibits SNARE pairing on its own when added early in the pathway; however, the effects of adding it during docking/tether on already formed SNARE complexes is unknown ( 49 ). It is worth remembering that blocking SNARE function does not affect the acidification of vacuoles as measured by AO fluorescence ( 41 ).…”

“…Vacuoles were isolated as described from BJ3505 genetic backgrounds and used for vacuole acidification and Ca 2+ transport assays ( Table 1 ) ( 15 , 16 , 41 , 86 , 87 ). STV1 was deleted by homologous recombination using PCR products amplified from pAG32 plasmid with primers 5′-STV1-KO (5’ – AGGCCCACGAAGGTGATTGGAAGTTCAGTGTTGAATCT GTTTAGCTTGCCTCGTCC – 3′) and 3′-STV1-KO (5′- GCAAACGTAGCGCATGCAACATTGCGTGGATGGCGGCGTTAGTATCGA – 3′), with homology flanking the STV1 coding sequence.…”

Sphingolipids regulate the tethering stage of vacuole fusion by affecting membrane fluidity

“…V-ATPase acidification of vacuoles was performed as previously described (Müller et al, 2003;Zhang et al, 2022aZhang et al, , 2022b. In vitro acidification reactions (60 µl) contained 20 µg BJ3505 background vacuoles, reaction buffer, ATP regenerating system, 10 µM CoA, 283 nM Pbi2, and 15 µM acridine orange (Sigma 65-61-2).…”