HMGB1 promotes the development of castration‑resistant prostate cancer by regulating androgen receptor activation

Abstract

AR signalling pathway reactivation plays a key role in the development of castration-resistant prostate cancer (CRPC). High-mobility group protein B1 (HMGB1) is an important factor involved in the occurrence and development of a variety of tumours by regulating gene transcription. In the present study, the association between HMGB1 and prostate cancer (PCa) and the effects of HMGB1 on androgen receptor (AR) transcription and signalling pathway reactivation in PCa cells in vitro and in vivo were evaluated. A bioinformatics method was used to determine the mRNA expression level of HMGB1 in PCa specimens and its correlation with the mRNA expression of AR. Immunohistochemical staining was used to detect the expression of these proteins in clinical PCa samples. Reporter gene and ChIP assays were performed to determine the activity of AR and the effect of HMGB1 on the ability of AR to bind to the promoters of prostate specific antigen and transmembrane protease, serine 2. A bioluminescence resonance energy transfer assay was employed to observe the direct interaction between HMGB1 and AR protein. Additionally, a castrated nude mouse xenograft tumour model was established to verify the effect of HMGB1 on PCa. The results revealed that HMGB1 expression was significantly increased in PCa specimens, which may have a strong correlation with AR expression. Moreover, HMGB1 could reactivate the AR signalling pathway, directly interact with AR, and promote the development of CRPC in an androgen-independent manner. The results of the present study indicated that HMGB1 promoted the development of CRPC by interacting with AR, which inferred that decreasing the expression of HMGB1 may be a potential effective method for CRPC prevention and treatment.

MCM10: An effective treatment target and a prognostic biomarker in patients with uterine corpus endometrial carcinoma

“…Immunohistochemical staining was performed as our previous study 19 . The sections were stained with rabbit anti‐MCM10 antibody (1:100; Affinity) and anti‐MKI67 antibody (1:400; Servicebio).…”

“…The following primers were used: MCM10 gene forward, 5'‐GGAGAGAACAACTTGCCTATCTG‐3' and reverse, 5'‐AGTAGCGCTCCTGCATCTCA‐3′; 𝛽‐actin gene forward, 5'‐GTGGCCGAGGACTTTGATTG‐3′ and reverse, 5'‐CCTGTAACAACGCATCTCATATT‐3′. The mRNA expression levels were quantified using 2−ΔΔCq method 19 …”

KNL1 is a prognostic and diagnostic biomarker related to immune infiltration in patients with uterine corpus endometrial carcinoma

“…Similar to an earlier study (31), immunohistochemical (IHC) staining was conducted. After 24 hours of fixation in 10% formalin at room temperature, the samples were embedded in paraffin and sectioned to a thickness of 3 µm.…”

“…An ABI-Q3 was used to conduct PCR at 94°C for 30 seconds, followed by 45 cycles of amplification at 94°C for 5 seconds, 51°C for 15 seconds, and 72°C for 10 seconds (Thermo Fisher Scientific, Inc.). The expression levels of the mRNA were measured using the 2 -DDCt method (31).…”

The Effect of HMGB1 and HMGB2 on Transcriptional Regulation Differs in Neuroendocrine and Adenocarcinoma Models of Prostate Cancer

“…HMGB1 and HMGB2 interact with other proteins encoded by genes whose expression is amplified by increasing copy number (genes with high copy number variations, CNVs) in tumors from patients diagnosed with these aggressive PCa cancers or in metastatic tumors; these genes are not amplified in primary adenocarcinomas [ 18 ]. Considering that the reactivation of the AR signaling pathway plays a key role in the development of CRPC, it is remarkable that direct interaction between HMGB1 and the AR protein has been detected, and also that HMGB1 influences the ability of AR to bind to the promoter of prostate-specific antigen (PSA) [ 19 ].…”