Host Feeding Patterns of<i>Culex</i>Mosquitoes and West Nile Virus Transmission, Northeastern United States

Molaei, Goudarz; Andreadis, Theodore G.; Armstrong, Philip M.; Anderson, John F.; Vossbrinck, Charles R.

doi:10.3201/eid1203.051004

Cited by 310 publications

(342 citation statements)

References 31 publications

Supporting

Mentioning

321

Contrasting

Unclassified

Order By: Relevance

“…pipiens as the primary enzootic vector in this region. Culex pipiens has been established as an important enzootic vector by consistent isolations of WNV from mosquito trap collections [11,13,20], by its ornithophilic feeding behaviour [13,40,41], and associations between virus-infected mosquitoes and dead bird reports [42][43][44][45][46]. This species has also been incriminated as a bridge vector in Illinois [47].…”

Section: Discussionmentioning

confidence: 99%

Vector host-feeding preferences drive transmission of multi-host pathogens: West Nile virus as a model system

et al. 2011

Self Cite

View full text Add to dashboard Cite

Seasonal epizootics of vector-borne pathogens infecting multiple species are ecologically complex and difficult to forecast. Pathogen transmission potential within the host community is determined by the relative abilities of host species to maintain and transmit the pathogen and by ecological factors influencing contact rates between hosts and vectors. Increasing evidence of strong feeding preferences by a number of vectors suggests that the host community experienced by the pathogen may be very different from the local host community. We developed an empirically informed transmission model for West Nile virus (WNV) in four sites using one vector species (Culex pipiens) and preferred and non-preferred avian hosts. We measured strong feeding preferences for American robins (Turdus migratorius) by Cx. pipiens, quantified as the proportion of Cx. pipiens blood meals from robins in relation to their abundance (feeding index). The model accurately predicted WNV prevalence in Cx. pipiens at three of four sites. Sensitivity analysis revealed feeding preference was the most influential parameter on intensity and timing of peak WNV infection in Cx. pipiens and a threshold feeding index for transmission was identified. Our findings indicate host preferenceinduced contact heterogeneity is a key mediator of vector-borne pathogen epizootics in multi-species host communities, and should be incorporated into multi-host transmission models.

show abstract

Section: Discussionmentioning

confidence: 99%

Vector host-feeding preferences drive transmission of multi-host pathogens: West Nile virus as a model system

et al. 2011

Self Cite

View full text Add to dashboard Cite

show abstract

“…Ornithophagic species within the genus Culex are important vectors and responsible for zoonotic WNV transmission among birds (Molaei et al 2006). Culex in California are quiescent or diapause during cold winter months (Nelms et al 2013a,b), and low temperatures hinder WNV replication within the overwintering mosquito hosts (Dohm et al 2002, Reisen et al 2006b).…”

mentioning

confidence: 99%

West Nile Virus Activity in a Winter Roost of American Crows (Corvus brachyrhynchos): Is Bird-To-Bird Transmission Important in Persistence and Amplification?

et al. 2015

View full text Add to dashboard Cite

Since its emergence in North America, West Nile virus (WNV) has had a large impact on equines, humans, and wild bird communities, yet gaps remain in our understanding of how the virus persists at temperate latitudes when winter temperatures preclude virus replication and host-seeking activity by mosquito vectors. Bird-to-bird transmission at large communal American Crow roosts could provide one mechanism for WNV persistence. Herein, we describe seasonal patterns of crow and Culex mosquito abundance, WNV infection rates, and the prevalence of WNV-positive fecal samples at a winter crow roost to test the hypothesis that bird-to-bird transmission allows WNV to persist at winter crow roosts. Samples were collected from large winter crow roosts in the Sacramento Valley of California from January 2013 until August 2014, encompassing two overwintering roost periods. West Nile virus RNA was detected in local crow carcasses in both summer [13/18 (72% WNV positive)] and winter [18/44 (41% WNV positive)] 2013-2014. Winter infections were unlikely to have arisen by recent bites from infected mosquitoes because Culex host-seeking activity was very low in winter and all Culex mosquitoes collected during winter months tested negative for WNV. Opportunities existed for fecal-oral transfer at the overwintering roost: most carcasses that tested positive for WNV had detectable viral RNA in both kidney and cloacal swabs, suggesting that infected crows were shedding virus in their feces, and >50% of crows at the roost were stained with feces by mid-winter. Moreover, 2.3% of fecal samples collected in late summer, when mosquitoes were active, tested positive for WNV RNA. Nevertheless, none of the 1,119 feces collected from three roosts over two winters contained detectable WNV RNA. This study provided evidence of WNV infection in overwintering American crows without mosquito vector activity, but did not elucidate a mechanism of WNV transmission during winter.

show abstract

“…Our bioinformatic analysis revealed that there was too little sequence diversity among the targeted sequences for microarray differentiation. As a substitute, we chose to model our approach after a study by Molei and others 26 using target-specific PCR of the Cytb gene for identification. The benefit to using this model was the significant amount of avian and mammalian Cytb gene sequence data available.…”

Section: Discussionmentioning

confidence: 99%

“…The PCR amplification was accomplished using the Cytb avian-a (forward, GACTGTGA CAAAATCCCNTTCCA; reverse, GGTCTTCATCTYHGG YTTACAAGAC) 24 and mammalian-a (forward, CGAAGC TTGATATGAAAAACCATCGTTG; reverse, TGTAGTTR TCWGGGTCHCCTA) 25 primers as previously desribed. 26 Amplicons were visualized using 2% Agarose E-Gel gels (Invitrogen Inc.). Biotin labeling and post-PCR purification.…”

Section: Methodsmentioning

confidence: 99%

Evaluation of a Field-Portable DNA Microarray Platform and Nucleic Acid Amplification Strategies for the Detection of Arboviruses, Arthropods, and Bloodmeals

Grubaugh¹,

Petz²,

Melanson³

et al. 2013

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. Highly multiplexed assays, such as microarrays, can benefit arbovirus surveillance by allowing researchers to screen for hundreds of targets at once. We evaluated amplification strategies and the practicality of a portable DNA microarray platform to analyze virus-infected mosquitoes. The prototype microarray design used here targeted the nonstructural protein 5, ribosomal RNA, and cytochrome b genes for the detection of flaviviruses, mosquitoes, and bloodmeals, respectively. We identified 13 of 14 flaviviruses from virus inoculated mosquitoes and cultured cells. Additionally, we differentiated between four mosquito genera and eight whole blood samples. The microarray platform was field evaluated in Thailand and successfully identified flaviviruses (Culex flavivirus, dengue-3, and Japanese encephalitis viruses), differentiated between mosquito genera (Aedes, Armigeres, Culex, and Mansonia), and detected mammalian bloodmeals (human and dog). We showed that the microarray platform and amplification strategies described here can be used to discern specific information on a wide variety of viruses and their vectors.

show abstract

Host Feeding Patterns ofCulexMosquitoes and West Nile Virus Transmission, Northeastern United States

Abstract: Culex salinarius is a bridge vector to humans, while Cx. pipiens and Cx. restuans are more efficient enzootic vectors.

Cited by 310 publications

References 31 publications

Vector host-feeding preferences drive transmission of multi-host pathogens: West Nile virus as a model system

Vector host-feeding preferences drive transmission of multi-host pathogens: West Nile virus as a model system

West Nile Virus Activity in a Winter Roost of American Crows (Corvus brachyrhynchos): Is Bird-To-Bird Transmission Important in Persistence and Amplification?

Evaluation of a Field-Portable DNA Microarray Platform and Nucleic Acid Amplification Strategies for the Detection of Arboviruses, Arthropods, and Bloodmeals

Contact Info

Product

Resources

About