Hot in Cold: Microbial Life in the Hottest Springs in Permafrost

Abstract

Chukotka is an arctic region located in the continuous permafrost zone, but thermal springs are abundant there. In this study, for the first time, the microbial communities of the Chukotka hot springs (CHS) biofilms and sediments with temperatures 54–94 °C were investigated and analyzed by NGS sequencing of 16S rRNA gene amplicons. In microbial mats (54–75 °C), phototrophic bacteria of genus Chloroflexus dominated (up to 89% of all prokaryotes), while Aquificae were the most numerous at higher temperatures in Fe-rich sediments and filamentous “streamers” (up to 92%). The electron donors typical for Aquificae, such as H2S and H2, are absent or present only in trace amounts, and the prevalence of Aquificae might be connected with their ability to oxidize the ferrous iron present in CHS sediments. Armatimonadetes, Proteobacteria, Deinococcus-Thermus, Dictyoglomi, and Thermotogae, as well as uncultured bacteria (candidate divisions Oct-Spa1-106, GAL15, and OPB56), were numerous, and Cyanobacteria were present in low numbers. Archaea (less than 8% of the total community of each tested spring) belonged to Bathyarchaeota, Aigarchaeota, and Thaumarchaeota. The geographical location and the predominantly autotrophic microbial community, built on mechanisms other than the sulfur cycle-based ones, make CHS a special and unique terrestrial geothermal ecosystem.

High Potential for Biomass-Degrading Enzymes Revealed by Hot Spring Metagenomics

“…More metadata would allow to contextualize and more directly compare different metagenome datasets as well as provide opportunities to identify possible trends of microbial community composition and function across various sampling efforts and studies. Several studies have attempted to test whetherthe microbial community composition of hot springs can be predicted based on geochemical parameters ( Inskeep et al, 2013b ; Campbell et al, 2017 ; Power et al, 2018 ; Kochetkova et al, 2020 ) but a lack in contextual data make comparison across datasets obtained by different laboratories challenging. Other than pH, temperature, location, and date of sample acquisition, which already need to be reported if a dataset is to be added to IMG/M, valuable parameters to report in future studies should include dissolved oxygen, salinity, sulfide, total and dissolved (in)organic carbon and nitrogen, as well as trace metal availability.…”

Sasso Pisano Geothermal Field Environment Harbours Diverse Ktedonobacteria Representatives and Illustrates Habitat-Specific Adaptations

“…Other high abundant taxa have evolved diverse strategies, for instance, most Anaerolineaceae species metabolise various organic carbon sources under anaerobic conditions through fermentative metabolism [ 56 ]. Representatives of the thermophilic Aquificae grow in hot springs via oxidation of dissolved ferrous iron or iron-containing minerals and conduct nitrogen fixation even at 70 °C [ 57 , 58 ]. Deinococci are resistant to several stresses due to their highly efficient DNA damage repair ability and detoxification of several toxic compounds through hydrolytic activity [ 59 , 60 ].…”

Culture-Independent Survey of Thermophilic Microbial Communities of the North Caucasus

“…Amplification was performed by CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). Cycling parameters were the same as described before [ 23 ]. Depending on the amplification curve the amplification mix was diluted 4–8 times and used as a matrix for the second PCR.…”

“…The second PCR was performed with ScreenMix-HS (Evrogen, Russia) using the following primers at 0.5 µM concentration: R1TM AATGATACGGCGACCACCGAGATCTACACA XXXXXX CGTCGGCAGCGTC and R2TM CAAGCAGAAGACGGCATACGAGAT XXXXXX GTCTCGTGGGCTCGG, where the first part corresponded to P5 or P7 Illumina flowcell oligonucleotides, XXXXXX corresponded to 6 nt index sequences and the last part corresponded to partial Illumina TruSeq adapters, annealing to the tail of first PCR primers ( Supplementary Table S7 ). Amplification was performed by Veriti Thermal Cycler (Applied Biosystems, Bedford, MA, USA) using cycling parameters, described previously [ 23 ]. Resulting libraries were checked on the agarose gel and pooled equimolarly.…”