Household peanut consumption as a risk factor for the development of peanut allergy

A, Fox; Sasieni, Peter; Toit, George Du; Syed, Huma; Lack, Gideon

doi:10.1016/j.jaci.2008.12.014

Cited by 335 publications

(255 citation statements)

References 32 publications

Supporting

Mentioning

243

Contrasting

Unclassified

Order By: Relevance

“…There is mixed evidence about a potential role of exposure to peanut in utero or through breast milk (8,9). Household use of peanut, independent of maternal or infant ingestion of peanut, is a risk factor for development of peanut allergy (10). Furthermore, peanut antigen is readily detectable in household dust (11,12), indicating that environmental exposure to peanut is likely.…”

Section: Introductionmentioning

confidence: 99%

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

195

208

View full text Add to dashboard Cite

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

show abstract

Section: Introductionmentioning

confidence: 99%

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

195

208

View full text Add to dashboard Cite

show abstract

“…The first, a comparative study of the UK and Israel (31) , showed that despite peanuts being introduced into the diet early in Israel, there is a low prevalence of peanut allergy; this has led to speculation that early introduction of peanuts, rather than avoidance, reduces the risk of peanut allergy. The second has highlighted the potential importance of environmental exposure (cutaneous contact and inhalation in the home) to 'household peanuts' in infancy in increasing the risk of peanut allergy (32) . This study concluded that peanut sensitisation occurs as a result of environmental exposure in infancy; high levels of environmental exposure appeared to promote sensitisation and low levels may be protective in atopic children.…”

Section: Discussionmentioning

confidence: 99%

Peanut sensitisation and allergy: influence of early life exposure to peanuts

et al. 2010

View full text Add to dashboard Cite

The aim of the present systematic review was to evaluate the influence of early life exposure (maternal and childhood) to peanuts and the subsequent development of sensitisation or allergy to peanuts during childhood. Studies were identified using electronic databases and bibliography searches. Studies that assessed the impact of non-avoidance compared with avoidance or reduced quantities of peanuts or peanut products on either sensitisation or allergy to peanuts, or both outcomes, were eligible. Six human studies were identified: two randomised controlled trials, two casecontrol studies and two cross-sectional studies. In addition, published animal and mechanistic studies, relevant to the question of whether early life exposure to peanuts affects the subsequent development of peanut sensitisation, were reviewed narratively. Overall, the evidence reviewed was heterogeneous, and was limited in quality, for example, through lack of adjustment for potentially confounding factors. The nature of the evidence has therefore hindered the development of definitive conclusions. The systematic review of human studies and narrative expert-led reviews of animal studies do not provide clear evidence to suggest that either maternal exposure, or early or delayed introduction of peanuts in the diets of children, has an impact upon subsequent development of sensitisation or allergy to peanuts. Results from some animal studies (and limited evidence from human subjects) suggest that the dose of peanuts is an important mediator of peanut sensitisation and tolerance; low doses tend to lead to sensitisation and higher doses tend to lead to tolerance.Peanut allergy: Diet: Prenatal exposure: Childhood exposure Onset of peanut allergy typically occurs in childhood, with 70-100 % (1) of peanut-allergic children being reported to react upon their first known dietary exposure to peanuts. Because IgE-mediated allergic reactions require prior exposure and immunological sensitisation to the allergen, this suggests that sensitisation has already been acquired, either in utero, or by unrecognised oral exposure or non-oral (cutaneous or respiratory) routes. As many as one in fiftyfive children in the UK may currently show evidence of an allergic reaction to peanuts (2) ; indeed, peanut allergy is the most common cause of severe allergic reaction to foods, causing 30 % of all cases of anaphylaxis outside hospital (3) . Data from the Isle of Wight UK Birth Cohort Study suggest a threefold rise in the prevalence of peanut sensitisation and allergy in children born between 1989-90 and 1994 -6 (4,5) . Recent data from children born in 2001 -2 show no further increases in the prevalence of peanut sensitisation and allergy (6) .In 1998 the UK Government issued precautionary advice to mothers whose children have a family history of allergic diseases, that they may wish to avoid peanut consumption during pregnancy and breast-feeding and avoid giving the child peanuts and peanut products until the child is 3 years of age (7) . The precautionary advice was...

show abstract

“…One study suggested that environmental exposure to food allergens during infancy as a result of household consumption may increase the risk of food allergy. In the study by Fox et al, higher household peanut consumption was associated with an increased risk of peanut allergy in infants [18]. Interestingly, early oral exposure to peanuts in infants appeared to protect against the increased risk seen with higher household peanut consumption.…”

Section: Development Of Immunological Tolerance To Foods and Implicatmentioning

confidence: 92%