Human vaginal epithelial cells augment autophagy marker genes in response to Candida albicans infection

Abstract

The results suggest that C. albicans invasion led to the activation of autophagy as a host defense mechanism of VECs.

Autophagy gene ATG5 knockdown upregulates apoptotic cell death during Candida albicans infection in human vaginal epithelial cells

“…Post‐treatments, total cellular RNA was extracted from all groups of VECs and first‐strand cDNA synthesis was carried out using protocols standardized in our previous study …”

“…Reverse transcriptase PCR (RT‐PCR) was carried out, and products were analyzed to detect the expression of ATG5, LC3, LAMP‐1, and 18S rRNA transcripts using conditions described in our previous study . The gene specific primers used were ATG5 (94 bp) (F‐5'‐ATCCTGCAGAAGAAAATGGA‐3'; R‐5'‐ACAGGACGAAACAGCTTCTG‐3'), LC3 (187 bp) (F‐5′‐AGCAGCATCCAACCAAAATC‐3′; R‐5′‐TGTGTCCGTTCACCAACAG‐3'), LAMP‐1 (195 bp) (F‐5′‐CTGCCTTTAAAGCTGCCAAC‐3′; R‐5′‐TGTTCTCGTCCAGCAGACAC‐3') and 18S rRNA (150 bp) (F‐5′‐CATTAAGGGTGTGGGCCGAA‐3; R‐'5′‐TGGGATCTTGTACTGGCGTG‐'3).…”

“…cDNA from each treatment group was used to quantify transcript levels of ATG5, LC3, LAMP‐1, and 18S rRNA using quantitative PCR (q‐PCR) with SYBR Green chemistry as described in our previous study . The primers used in RT‐PCR were also used in q‐PCR.…”

“…Post‐treatment, total protein was extracted from all groups of VECs using methods described in our previous study …”

“…Macrophages infected with C. albicans show the presence of autophagy marker, LC3, on vacuoles entrapping the pathogen . Our previous studies have shown that C. albicans infection upregulates LC3 as well as LAMP‐1 in human vaginal epithelial cells . Autophagy and apoptosis have cross talk at multiple levels under various conditions such as inflammation, infections, and cancer .…”