Babesia gibsoni cytochrome b mutations in canine blood samples submitted to a US veterinary diagnostic laboratory

Abstract

Background: Babesiosis caused by Babesia gibsoni is recognized throughout the world and can be difficult to treat. Resistance to atovaquone is associated with mutations in the B. gibsoni mitochondrial genome, specifically the M128 position of cytochrome b (cytb). The prevalence of cytb mutations in North America has not been reported. Hypothesis/Objectives: The objective of our study was to describe the prevalence of cytb M128 mutations in B. gibsoni in canine blood samples submitted to a US veterinary diagnostic laboratory. A secondary objective was to determine whether or not some dogs had wild‐type cytb in our initial samples then had M128 mutations detected in follow‐up samples. Animals: One‐Hundred seventy‐four dogs that tested positive for the presence of B. gibsoni between 2012 and 2017. Methods: Case series of consecutive samples submitted to a veterinary diagnostic laboratory. Partial B. gibsoni cytb genes were amplified by polymerase chain reaction and screened for the presence of mutations at the M128 position. Results: The overall prevalence of M128 mutants was 3.5% (6/173 dogs) in the initial samples. The incidence of new cytb mutants in dogs that tested positive for B. gibsoni, which then had follow‐up testing, was 12.1% (5/41). Conclusions and Clinic Importance: Our study reaffirms that B. gibsoni infection is widespread and most commonly detected in American Staffordshire Terrier/American Pit Bull Terrier dogs (128/174, 74% of the infected dogs in our study). The prevalence of cytb mutations does not warrant pretreatment genotyping.

An alternative combination therapy with metronidazole, clindamycin and doxycycline for <i>Babesia gibsoni</i> (Asian genotype) in dogs in Hong Kong

“…Possible reasons for this discrepancy include the development of drug resistance associated to the mutation in cytochrome b genes, false positives, a difference in parasite load due to a higher prevalence of B. gibsoni in Hong Kong compared to the US, or the failure of drug dosing compliance by clients. Atovaquone resistance due to an M121I variant population has been reported as a potential cause of treatment failure [ 5 , 13 , 17 , 28 ]. Quantification of an M121I variant population by allele-specific real-time PCR was not performed in the present study, therefore the authors were unable to determine how many MCD success cases might have been resistant M121I strains.…”

“…Atovaquone and azithromycin (AA) is currently considered the first-line therapy for B.gibsoni infection in most countries worldwide. Although AA appears to effectively ameliorate clinical signs, it has been associated with high relapse rates presumably due to atovaquone resistance associated with B. gibsoni cytb gene mutations [5,13,28]. The need to explore alternative therapies has therefore become necessary.…”

“…Possible reasons for this discrepancy include the development of drug resistance associated to the mutation in cytochrome b genes, false positives, a difference in parasite load due to a higher prevalence of B. gibsoni in Hong Kong compared to the US, or the failure of drug dosing compliance by clients. Atovaquone resistance due to an M121I variant population has been reported as a potential cause of treatment failure[5,13,17,28].…”

Babesia gibsoni emerging with high prevalence and co-infections in “fighting dogs” in Hungary

“…(2019) MHR1 GCTGATACAATATAGGATCTCC Wickramasekara Rajapakshage et al. (2012) Babesia gibsoni cytb 427F GCATTCTTAGGTTATGTTTTACCAA 800 95 °C for 5 min; 35 × (95 °C for 40 s; 53 °C for 40 s; 72 °C for 90 s); 72 °C for 7 min Birkenheuer et al. (2018) CYTbR1 ATATGCAAACTTCCCGGCTA Wickramasekara Rajapakshage et al.…”

“…Considering the epidemiology of B. gibsoni infection, this piroplasm can also be acquired transplacentally ( Fukumoto et al., 2005 ). However, the predominant mode of its transmission appears to be through bite wounds ( Kirk et al., 2017 ), in which cases usually illegal dog “fighting” and relevant breeds (American Staffordshire Terrier and American Pit Bull Terrier) are involved ( Kirk et al., 2017 ; Birkenheuer et al., 2018 ). These dogs frequently have co-infections with other hemotropic pathogens which are also able to spread via dog bites, as exemplified by B. vulpes and canine hemotropic mycoplasmas ( Mycoplasma haemocanis and “ Candidatus Mycoplasma haematoparvum”) ( Cannon et al., 2016 ; Barash et al., 2019 ).…”