Identical splicing of aberrant epidermal growth factor receptor transcripts from amplified rearranged genes in human glioblastomas.

Abstract

The epidermal growth factor receptor gene has been found to be amplified and rearranged in human glioblastomas in vivo. Here we present the sequence across a splice junction of aberrant epidermal growth factor receptor transcripts derived from corresponding and uniquely rearranged genes that are coamplified and coexpressed with nonrearranged epidermal growth factor receptor genes in six primary human glioblastomas. Each of these six tumors contains aberrant transcripts derived from identical splicing of exon 1 to exon 8 as a consequence of a deletion-rearrangement of the amplified gene, the extent of which is variable among these tumors. In spite of this intertumoral variability, each intragenic rearrangement results in loss of the same 801 coding bases (exons 2-7) and creation ofa new codon at the novel splice site in their corresponding transcripts. These rearrangements do not, however, affect the mRNA sequence for the signal peptide, the first five codons, or the reading frame downstream of the rearrangement.The normal epidermal growth factor receptor (EGFR) gene product is a 170-kDa transmembrane glycoprotein found on many normal and malignant cells (1-7). The extracellular binding of one of its two known endogenous ligands, epidermal growth factor and transforming growth factor a, results in conformational changes of the extracellular domain (8), the activation of the receptor's intracellular tyrosine kinase activity (9,10), and the stimulation of DNA synthesis. A constitutively activated and cell-transforming variant of this receptor, with most of the extracellular domain deleted and further carboxyl-terminal deletions and mutations, is encoded by the v-erbB oncogene of avian erythroblastosis virus (11,12). In brain tumors, EGFR gene amplification is exclusively seen in the most malignant variants of adult gliomas, especially the glioblastomas (13). Studies of DNA, mRNA, and protein from primary human glioblastomas and xenografted glioblastomas indicate that EGFR gene rearrangements are frequently associated with EGFR amplification in such tumors (1, 14-21); most results suggest rearrangements causing the loss of coding sequences for the extracellular domain (17,18,20).We have studied the DNA and RNA from primary tumor tissue from six patients with brain tumors histopathologically classified as glioblastomas (22,23) where the tumors were determined to have amplification of the EGFR gene (13).Here we demonstrate that each of these tumors has highly expressed aberrant EGFR transcripts resulting from identical coerced splicing of uniquely rearranged and amplified EGFR genes.

Suppression of EGFR expression by antisense or small interference RNA inhibits U251 glioma cell growth in vitro and in vivo

“…Gene therapy targeting TK domain in glioma therapy EGFR gene consists of 28 exons and encodes a 170 kDa of glycoprotein, comprising an extracellular region (encoded by exons 1-16), a membrane spanning region (encoded by exon 17) and an intracellular region (encoded by exons [18][19][20][21][22][23][24][25][26][27][28]. 19 The extracellular portion of EGFR is Figure 5 Compare to the group of PBS and psiRNA-scr, tumor growth in nude mice in the group of psiRNA-EGFR and panti-EGFR were inhibited (Po0.001) (a), EGFR expression of tumors was downregulated (b), GFAP expression was upregulated (c), apoptosis cells become obvious by TUNEL staining (d), and PCNA expression was downregulated (Po0.001) (e).…”

“…21 This variant produces a unique functional peptide, and renders the EGFR unable to bind any known ligand, while harboring constitutive kinase activity independent of ligand binding. 22 Despite this, glioma cells transfected with EGFRvIII have enhanced tumorigenicity when grown as xenografts in nude mice.…”

Monoclonal antibody against the fusion junction of a deletion-mutant epidermal growth factor receptor

“…Single-stranded cDNA was produced using Moloney murine leukaemia virus reverse transcriptase and random primer with hexanucleotides. The single-stranded cDNA was then subjected to PCR using a sense probe (PC 66;CTTCGGGGAGCAGCGATGCGAC) and an antisense probe (PC 77; 1167-1146; GAATGT-GAACGCCTGCGGCAGA) (Sugawa et al, 1990 (Figure 4). In contrast, EGFR and A431 cells were stained with EGFR1 antibody, but not with 3C10 antibody.…”

Molecular pathology of lung cancer: key to personalized medicine

“…[89][90][91] A number of functional differences between EGFRvIII and EGFR have been characterized. 90,91 EGFRvIII has been identified in an array of human solid tumors, including glioblastoma, breast cancer, ovarian cancer, prostate cancer, and lung caner.…”