Identification and characterization of ethanol utilizing fungal flora of oil refinery contaminated soil

Abstract

The indigenous fungal flora of three oil refinery contaminated sites (Bharuch, Valsad and Vadodara) of India has been documented in the present investigation. A total seventy-five fungal morphotypes were isolated from these sites and out of them, only fifteen isolates were capable of utilizing ethanol (0-8%; v:v) as a sole source of carbon and energy for growth. Ten percent ethanol was completely lethal for the growth of all the isolated fungus. Biochemical characterization of the potent ethanol utilizing fungal isolates was studied based on substrate utilization profiles using BIOLOG phenotype microarray plates. Based on the morphological characters and Internal Transcribed Spacer region of ribosomal DNA, the fungal isolates were identified as Fusarium brachygibbosum, Fusarium equiseti, Fusarium acuminatum, Pencillium citrinum, Alternaria tenuissima, Septogloeum mori, Hypocrea lixii, Aureobasidium sp., Penicillium sp., and Fusarium sp. Intra-species genetic diversity among Fusarium sp. was evaluated by whole genome analysis with repetitive DNA sequences (ERIC, REP and BOX) based DNA fingerprinting. It was found that these fungus use alcohol dehydrogenase and acetaldehyde dehydrogenase enzymes based metabolism pathway to utilize ethanol for their growth and colonization.

The culturable mycobiota of a Mediterranean marine site after an oil spill: isolation, identification and potential application in bioremediation

“…S. racemosum is well known for its ability to oxidize aromatic compounds as benzo [a]pyrene (Cerniglia, 1997). A. tenuissima has already been recovered in an oil refinery contaminated soil and was able to use ethanol as sole carbon source (Srivastava et al, 2014). C. globosum has been reported in fuel tanks but, its ability to use crude oil was not assessed (Gaylarde et al, 1999).…”

Identification, characterization and phylogenetic analysis of antifungal Trichoderma from tomato rhizosphere

“…Molecular characterization of Trichoderma isolates was assessed by rep-PCR using the BOXA1R, Rep1R-I, Rep2-I, ERIC-1R and ERIC-2F primers (Srivastava et al 2014). All the PCR reactions were carried out in 25 μl reaction mixture containing 5× Gitschier buffer, 50 ng DNA template, 2 mM MgCl 2 , 0.25 mM dNTP mixture and 0.25 μM each of primer, and one unit of Taq Polymerase (Bangalore Genie, India).…”

“…This has already resulted in incorrect identification. In recent years, the usefulness of molecular markers such as random amplified polymorphic DNA (RAPD) and repetitive-element polymerase chain reaction (REP-PCR) in resolving species differences among microbial species are also well documented (Sharma et al 2009; Solanki et al 2013; Srivastava et al 2014; Singh et al 2014; Kashyap et al 2015). RAPD utilized PCR to amplify DNA segments with single primer of arbitrary nucleotide sequence generating fragments by hybridizing with compatible regions of DNA and amplifying the regions where the primers are in correct orientation and appropriately spaced (100–2500 bp).…”

Mating type genes and genetic markers to decipher intraspecific variability among Fusarium udum isolates from pigeonpea

“…One approach involves the exploitation of ubiquitously conserved known genes that display sequence variation. In particular, comparative nucleotide sequencing of rDNA subunits, such as ITSs, has been used widely for distinguishing between fungal species, and to develop specific protocols for identifying fungal species . Another approach involves the screening of random parts of the genome to identify distinctive nucleotide sequences by techniques, such as microsatellites, RAPD, ERIC‐ and BOX‐PCR.…”

“…Genetic diversity among Fu isolates was analyzed by rep‐ PCR using the BOXA1R (5′‐CTACGG CAAGGCGACGCTGACG‐3′), ERIC 1 R (5′‐ATGTAAGCTCCTGGGGATTCA‐3′) and ERIC 2 F (5′‐AAGTAAGTGACTGGGGTGAGC‐3′) primers . All the PCR reactions were carried out in 25 μl reaction mixture containing 5× Gitschier buffer, 50 ng DNA template, 2 mM MgCl 2, 25 mM dNTP mixture, 50 pmol of each of primer, and one unit of Taq DNA polymerase (Bangalore Genie, India).…”