Identification of a missense HOXD13 mutation in a Chinese family with syndactyly type I-c using exome sequencing

Abstract

Syndactyly is one of the most common hereditary limb malformations, and is characterized by the fusion of specific fingers and/or toes. Syndactyly type I‑c is associated with bilateral cutaneous or bony webbing of the third and fourth fingers and occasionally of the third to fifth fingers, with normal feet. The aim of the present study was to identify the genetic basis of syndactyly type I‑c in four generations of a Chinese Han family by exome sequencing. Exome sequencing was conducted in the proband of the family, followed by direct sequencing of other family members of the same ancestry, as well as 100 ethnically‑matched, unrelated normal controls. A missense mutation, c.917G>A (p.R306Q), was identified in the homeobox D13 gene (HOXD13). Sanger sequencing verified the presence of this mutation in all of the affected family members. By contrast, this mutation was absent in the unaffected family members and the 100 ethnically‑matched normal controls. The results suggest that the c.917G>A (p.R306Q) mutation in the HOXD13 gene, may be responsible for syndactyly type I‑c in this family. Exome sequencing may therefore be a powerful tool for identifying mutations associated with syndactyly, which is a disorder with high genetic and clinical heterogeneity. The results provide novel insights into the etiology and diagnosis of syndactyly, and may influence genetic counseling and the clinical management of the disease.

Identification of a GNE homozygous mutation in a Han‐Chinese family with GNE myopathy

“…Filtrations of all identified variations were performed based on following references: mean coverage ≥100, mutation ratio ≥10, absence of mutation in 1000 Genomes Project and non‐synonymous mutations . Direct Sanger sequencing confirmed the potential pathogenic variant via an ABI3500 sequencer (Applied Biosystems, Foster City, CA, USA) . PCR amplification and Sanger sequencing primer sequences are as follows: 5′‐CCTTGTGTTTGTGGTGGAGC‐3′ and 5′‐CCTCTTACCTGTGCCTGTGA‐3′.…”

“…13,14 Direct Sanger sequencing confirmed the potential pathogenic variant via an ABI3500 sequencer (Applied Biosystems, Foster City, CA, USA). [15][16][17] PCR amplification and Sanger sequencing primer sequences are as follows: 5′-CCTTGTGTTTGTGGTGGAGC-3′ and 5′-CCTCTTACCTGT GCCTGTGA-3′.…”

A Nonsense Mutation in <i>HOXD13</i> Gene from A Chinese Family with Non-Syndromic Synpolydactyly

“…Currently, aberrant polyalanine expansion in the polyalanine tract of the HOXD13 gene was reported in numerous unrelated families with classical phenotypes of SPD (Kjaer et al 2005;Horsnell et al 2006;Gong et al 2011;Xin et al 2012), and it leads to misfolding, degradation or cytoplasmic aggregation of those mutant products through dominant negative effect (Brison et al 2014). Loss-offunction mutations in the homeodomain (in exon 2 of HOXD13) were usually found in the patients with minor variants and unusual phenotypes of SPD (Kan et al 2003;Kurban et al 2011;Dai et al 2014;Deng et al 2017). Functional haploinsufficiency caused by truncating mutations in HOXD13 is almost the most plausible mechanism.…”

“…The molecular mechanism of SPD is still ambiguous and difficult to be explored. Typical SPD is generally caused by aberrant expansions of a 15-residue polyalanine tract in homeobox D13 (HOXD13), while the patients with minor variants and unusual phenotypes are provoked by minor mutations (small deletions/insertions, nonsense and missense mutations) in the homeodomain of HOXD13 (Kurban et al 2011;Xin et al 2012;Deng et al 2017). The other genes that are associated with SPD have also been reported (Johnston and Kirby 1955;Cenani and Lenz 1967;Debeer et al 2002;Li et al 2010;Wieczorek et al 2010;Dimitrov et al 2010), which makes the relationship between the phenotypes and genotypes of SPD much intricate.…”

Detection of a Novel Mutation on the Gene ESCO2 in a Pediatric Patient with Syndactyly

“…Đối với bệnh dính ngón chân tay dạng I-c, cho đến nay mới chỉ có một đột biến trên gen HOXD13 c.917G > A (p.R306Q) được công bố phát hiện trên một phả hệ gia đình người Trung Quốc gồm 5 thành viên bị dính ngón dạng này [12]. Ngoài ra, một số gen cũng được phát hiện ở một vài gia đình có bệnh nhân dính ngón thuộc các dạng khác như gen FBLN1 liên quan đến dính ngón dạng II [13], gen LMBR1 liên quan đến dạng IV [14], hay gen LRP4 liên quan đến dạng VII [15].…”