Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica

Abstract

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

Characterisation of the nicotianamine aminotransferase and deoxymugineic acid synthase genes essential to Strategy II iron uptake in bread wheat (Triticum aestivum L.)

“…Furthermore, multiple cis -acting regulatory elements that are known to confer pollen- and anther-specific expression in rice, tomato ( Solanum lycopersicum ) and tobacco were located in close proximity to, and downstream of, the TaNAAT2 TATA-box [36–40]. These elements may contribute to the high level of TaNAAT2 gene expression that we observed within the anther tissues of bread wheat.…”

“…The coding sequences of all TaNAAT1 , TaNAAT2 and TaDMAS1 genes were then validated using BLASTN searches to the TGACv1 genome assembly (http://pre.plants.ensembl.org/Triticum_aestivum/Info/Index), all of which returned a single TGAC scaffold with ≥99% identity. Annotation of cis -acting elements within the 1kb promoter regions of the TaNAAT and TaDMAS1 genes included: PB Core (CCAC), the enhancer elements LAT52 (TGTGG) and LAT56 (TGTGA), the pollen-specific enhancer element LAT52 (AGAAA), and the g10 late pollen gene element (GTGA) [36–40]. The cis -acting IDE1 (ATCAAGCATGCTTCTTGC) and IDE2-like (TTGAACGGCAAGTTTCACGCTGTCACT) elements were identified as previously described with a minimum of 51% sequence identity [51].…”

Comparative sequence and expression analysis of tapetum specific male sterility related genes in Medicago truncatula

“…REC and S_TKc domains are correlated with disease resistance. In a study of O. sativa, the REC domain was found to be associated with phosphoric acid signal recognition receptors, and the S_TKc domain was found to be associated with serine and threonine protein kinase family; genes containing these two domains are believed to be involved in disease resistance (Manimaran et al, 2015). UBCc, a ubiquitin combined with an enzyme E2 catalytic domain structure, was found in a cloned ZmPHO2 protein in inbred maize lines and is related to the dynamic balance of phosphorus in plants.…”

“…CACTFTPPCA1 enhances the expression of light reaction components (Wilson and Zhang, 2009). GTGANTG10 and POLLENLELAT52 are enhancer elements of LAT52 and LAT56, and are essential for high expression levels in pollen (Manimaran et al, 2015). The TATA box is an essential element of the eukaryotic promoter and controls the accuracy and frequency of transcription (Van Opijnen et al, 2004).…”

“…We selected a 2000-bp promoter region upstream of the start codon of each gene to search for possible cis-elements (Manimaran et al, 2015).…”