Identification of histaminergic neurons through histamine 3 receptor-mediated autoinhibition

Luca, Roberto De; Suvorava, Tatsiana; Yang, Danqing; Baumgärtel, Wilhelm; Kojda, Georg; Haas, Helmut L.; Sergeeva, Olga A.

doi:10.1016/j.neuropharm.2015.08.025

Cited by 21 publications

(14 citation statements)

References 54 publications

(94 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At the end of the recording of VTA neurons, cytoplasm was aspirated into the patch pipette and expelled into a PCR tube as previously described [40,41]. The following protocol of single cell RT-PCR was designed to detect the presence of mRNA coding for TH.…”

Section: Single-cell Rt-pcrmentioning

confidence: 99%

See 1 more Smart Citation

Superior Colliculus GABAergic Neurons Are Essential for Acute Dark Induction of Wakefulness in Mice

et al. 2019

View full text Add to dashboard Cite

show abstract

Section: Single-cell Rt-pcrmentioning

confidence: 99%

“…Second, nested PCR was carried out using Premix Taq (RR901A, Takara) with nested primers for the TH gene. The multiplex primer and the complex primer were adopted as described previously [41]. The final PCR products were verified.…”

Section: Single-cell Rt-pcrmentioning

confidence: 99%

Superior Colliculus GABAergic Neurons Are Essential for Acute Dark Induction of Wakefulness in Mice

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Primers for the amplification of mouse H2R were as follows: up:5′‐GGCCAAGAAGTGAGTGTAGA‐3′and lo: 5′‐GAAGAGGTTGAGGATGGAAG‐3′ (as in; expected PCR product size: 366 b.p.). Primers for the organic cation transporter 3 (OCT 3) were the same as in our previous study . Primers for mouse Homer1A, ARC, EGR1, and EGR2 are listed in Table .…”

Section: Methodsmentioning

confidence: 99%

“…Primers for the organic cation transporter 3 (OCT 3) were the same as in our previous study. 33 Primers for mouse Homer1A, 36 ARC, EGR1, and EGR2 37 are listed in Table 1. Several house keeping genes (HKG): GAPDH, RPl13a, beta-actin (actB), and Hsp90 27 were compared in our initial experiments.…”

Section: Real-time Rt-pcrmentioning

confidence: 99%

Histamine‐induced plasticity and gene expression in corticostriatal pathway under hyperammonemia

et al. 2019

Self Cite

View full text Add to dashboard Cite

Aims Histamine H3 receptor (H3R) antagonists/inverse agonists increase vigilance. We studied brain histaminergic pathways under hyperammonemia and the transcriptome of receptors and their signaling cascades to provide a rationale for wake‐promoting therapies. Methods We analyzed histamine‐induced long‐lasting depression of corticostriatal synaptic transmission (LLDhist). As the expression of dopamine 1 receptors (D1R) is upregulated in LGS‐KO striatum where D1R‐H3R dimers may exist, we investigated actions of H3R and D1R agonists and antagonists. We analyzed transcription of selected genes in cortex and dorsal striatum in a mouse model of inborn hyperammonemia (liver‐specific glutamine synthetase knockout: LGS‐KO) and compared it with human hepatic encephalopathy. Results LGS‐KO mice showed significant reduction of the direct depression (DD) but not the long‐lasting depression (LLD) by histamine. Neither pharmacological activation nor inhibition of D1R significantly affected DDhist and LLDhist in WT striatum, while in LGS‐KO mice D1R activation suppressed LLDhist. Histaminergic signaling was found unchanged at the transcriptional level except for the H2R. A study of cAMP‐regulated genes indicated a significant reduction in the molecular signature of wakefulness in the diseased cortex. Conclusions Our findings provide a rationale for the development of aminergic wake‐promoting therapeutics in hyperammonemic disorders.

show abstract

“…In animals with an experimental neuropathy, locus coeruleus administration of histamine or an antagonist of the histamine H 3 receptor, an autoreceptor inhibiting histamine release from histaminergic nerve fibers (Arrang et al, 1983;De Luca et al, 2015), have been shown to attenuate neuropathic pain hypersensitivity (McGaraughty et al, 2012;Wei et al, 2014). However, the effect of spinal histamine or histamine receptors on neuropathic pain is not yet well known.…”

Section: Introductionmentioning

confidence: 99%

Spinal histamine in attenuation of mechanical hypersensitivity in the spinal nerve ligation-induced model of experimental neuropathy

Wang

Viisanen

You

et al. 2016

European Journal of Pharmacology

View full text Add to dashboard Cite

Here we studied whether and through which mechanisms spinal administration of histamine dihydrochloride (histamine) attenuates pain behavior in neuropathic animals. Experiments were performed in rats with spinal nerve ligation-induced neuropathy and a chronic intrathecal catheter for spinal drug delivery. Mechanical hypersensitivity was assessed with monofilaments while radiant heat was used for assessing nociception. Ongoing neuropathic pain and its attenuation by histamine was assessed using conditioned place-preference test. Following spinal administration, histamine at doses 0.1-10µg produced a dose-related mechanical antihypersensitivity effect. With prolonged treatment (twice daily 10µg for five days), the antihypersensitivity effect of spinal histamine was reduced. In place-preference test, neuropathic animals preferred the chamber paired with histamine (10µg). Histamine (10µg) failed to influence heat nociception in neuropathic animals or mechanically induced pain behavior in a group of healthy control rats. Histamine-induced mechanical antihypersensitivity effect was prevented by spinal pretreatment with zolantidine (histamine H2 receptor antagonist), prazosine (α1-adrenoceptor antagonist) and bicuculline (γ-aminobutyric acid subtype A, GABA(A), receptor antagonist), but not by pyrilamine (histamine H1 receptor antagonist), atipamezole (α2-adrenoceptor antagonist), or raclopride (dopamine D2 receptor antagonist). A-960656, a histamine H3 receptor antagonist alone that presumably increased endogenous histamine levels reduced hypersensitivity. Additionally, histamine prevented central (presumably postsynaptically-induced) facilitation of hypersensitivity induced by N-methyl-d-aspartate. The results indicate that spinal histamine at the dose range of 0.1-10µg selectively attenuates mechanical hypersensitivity and ongoing pain in neuropathy. The spinal histamine-induced antihypersensitivity effect involves histamine H2 and GABA(A) receptors and (presumably neuropathy-induced) co-activation of spinal α1-adrenoceptors.

show abstract

Identification of histaminergic neurons through histamine 3 receptor-mediated autoinhibition

Cited by 21 publications

References 54 publications

Superior Colliculus GABAergic Neurons Are Essential for Acute Dark Induction of Wakefulness in Mice

Superior Colliculus GABAergic Neurons Are Essential for Acute Dark Induction of Wakefulness in Mice

Histamine‐induced plasticity and gene expression in corticostriatal pathway under hyperammonemia

Spinal histamine in attenuation of mechanical hypersensitivity in the spinal nerve ligation-induced model of experimental neuropathy

Contact Info

Product

Resources

About