Identification of human and bovine rotavirus serotypes by polymerase chain reaction

Taniguchi, Koki; Wakasugi, F.; Pongsuwanna, Yaowapa; Urasawa, Tomoko; Ukae, Susumu; Chiba, Shunzo; Urasawa, Shozo

doi:10.1017/s0950268800050263

Cited by 118 publications

(89 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The identification of six serotype specific regions on the VP7 gene by Green et al [1987], led to the development of reverse transcriptase-polymerase chain reaction (RT-PCR) assays. Results with the RT-PCR method showed excellent correlation with results generated by serotype specific monoclonal antibodies [Taniguchi et al, 1992] and therefore, G types are often referred to as G serotype, even if determined by molecular means. Unlike the G serotype, concordance between the assignment of VP4 serotype and VP4 genotype are inconsistent [Padilla-Noriega et al, 1998] and therefore, a dual P classification system has been adopted where P genotypes are written between square brackets (P[8]) and P serotypes are written normally (P1a) [Gentsch et al, 2005] [Hoshino and Kapikian, 2000;Gentsch et al, 2005;Khamrin et al, 2007;Martella et al, 2007;Parra et al, 2007;Steyer et al, 2007a].…”

Section: Introductionmentioning

confidence: 87%

“…Initially, VP7 specific monoclonal antibodies were utilized to distinguish between G serotypes in enzyme-linked immunosorbent assays (ELISAs) [Taniguchi et al, 1992;Coulson, 1996]. However, in most studies 20-30% of all specimens failed to serotype and alternative techniques for characterization were investigated [Gouvea et al, 1990;Coulson, 1996].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The detection and molecular characterization of human G12 genotypes in South Africa

Page

Beer

Seheri

et al. 2008

Journal of Medical Virology

View full text Add to dashboard Cite

The last decade has seen an increase in the detection of rotavirus strains other than G1–G4 emerging or even predominating in some settings. The performance of the current rotavirus vaccines against unusual or rare circulating rotavirus serotypes cannot be predicted and continuous monitoring of wild type rotaviruses will remain a priority. Routine molecular rotavirus surveillance conducted in the Gauteng Province, South Africa during 2004, resulted in the detection of strains that could not typed using standard G specific genotyping primers. Sequencing of the first round amplicons revealed 19 serotype G12P[6] strains and one G12P[8] strain. Phylogenetic analyses of the G12 strains indicated that these strains are probably a recent introduction into South Africa and emerged from a strain related to the Indian isolate ISO‐5. The association of the South African G12s with the P[6] genotype may suggest a mechanism for unusual strains to become more ecologically suited to local population transmission dynamics. This is the first report of serotype G12 strains on the African continent and continued surveillance will be required to track the emergence of G12 strains in Africa. J. Med. Virol. 81:106–113, 2009. © 2008 Wiley‐Liss, Inc.

show abstract

Section: Introductionmentioning

confidence: 87%

Section: Introductionmentioning

confidence: 99%

The detection and molecular characterization of human G12 genotypes in South Africa

Page

Beer

Seheri

et al. 2008

Journal of Medical Virology

View full text Add to dashboard Cite

show abstract

“…ELISA-serotyping has been widely and successfully employed to survey serotype distribution [7][8][9][10][11][12][13][14][15]. In addition, a polymerase chain reaction (PCR) to identify serotypes of rotavirus was also developed to assign rotavirus serotypes which could not been determined by ELISA-serotyping [16,17].…”

mentioning

confidence: 99%

“…PCR-typing was performed in two steps (first and second amplifications) also as described previously [16,17].…”

mentioning

confidence: 99%

Distinct yearly change of serotype distribution of human rotavirus in Thailand as determined by ELISA and PCR

et al. 1993

Self Cite

View full text Add to dashboard Cite

SUMMARYA total of 241 group A rotavirus-positive stool samples collected from diarrhoeic patients in Thailand between July 1988 and June 1991 were characterized for their serotypes by enzyme-linked immunosorbent assay (ELISA) using serotype-specific monoclonal antibodies and by a polymerase chain reaction (PCR). In July 1988-June 1989, serotype 1 was the most prevalent (63-4%), followed by serotype 4 (1IO0%) and serotype 2 (8-5 %). In July 1989-June 1990, 59-8 % were serotype 1, 24-3 % were serotype 2, and 6 1 % were serotype 3. In contrast, in July 1990-June 1991, serotype 3 was detected in the highest frequency (40-5 %), 29-9 % were serotype 1, and 27-3 % were serotype 2. Thus, a distinct yearly change of serotype distribution of rotavirus in Thailand was observed in the three consecutive years. In particular, it was of note that the prevalence of serotype 3 greatly increased, in contrast to the previous studies in which almost no serotype 3 rotaviruses were detected in the years 1983-8 in Thailand.Rotavirus is a major cause of diarrhoea in infants and young children worldwide [1,2]. The mortality rate in rotavirus diarrhoea is high in areas where therapy for dehydration is not sufficiently available. Because of the importance of this disease as a major global health problem, the World Health Organization considers the development of an effective rotavirus vaccine to have a high public health priority. However, the antigenic complexity of rotavirus has hampered the development of an effective vaccine [1,3]. Epidemiological studies on distribution of human rotavirus serotypes provide the basis for interpreting the results of field trials of candidate vaccines.

show abstract

“…Genomic RNA was extracted from fecal specimens or tissue culture isolates with TRIZOL, LS reagent (Invitrogen, Carlsbad, CA) as per manufacturer's instructions and resolved by PAGE on 7.5% (w/v) polyacrylamide slab gel with 4% stacking gel. Further, the isolates were G typed by RT-PCR as described by Taniguchi et al [1992]. At first, amplification of the fulllength VP7 gene was done, using reverse primer C1 (GGTCACATCATACAATTCTAATCTAAG, nucleotide position 1062-1036) and forward primer C2 (GG-CTTTAAAAGAGAGAATTTCCGTCTGG, nucleotide position 1-28).…”

mentioning

confidence: 99%

Dual infection due to simian G3—human reassortant and human G9 strains of rotavirus in a child and subsequent spread of serotype G9, leading to diarrhea among grandparents

Awachat

Kelkar

2005

Journal of Medical Virology

View full text Add to dashboard Cite

Cultivation of rotavirus from day 1 and 3 fecal specimens of a child yielded simian SA11-human reassortant, G3P [8] and AU32 like G9P [8] rotavirus strains, respectively. Diarrhea developed in the grandfather by sheer hospital visits, and in the grandmother, after wiping the vomit of the grandfather. AU32 like G9 strains were isolated from the grandparents also. Rotavirus specific IgM developed in all the three patients. A fourfold rise in G9 neutralizing antibodies was observed in the child and grandmother. The child's mother had asymptomatic rotavirus infection. The study highlights the potential of G9 serotype to spread from children to adults. J. Med. Virol. 78:134-138, 2006. ß 2005 KEY WORDS: rotavirus; adult diarrhea; simian G3 SA11-human reassortant; G9 serotype; dual infection Group A rotavirus is known as the major cause of severe dehydrating diarrhea in infants. More than 90% of children get rotavirus infection by 3 years of age. Generally, group A rotavirus is a common cause of pediatric diarrhea but less common among adults, who appear to undergo rotavirus infections mostly with minimal or no clinical manifestations [Kapikian et al., 2001]. On the contrary, group B rotavirus was involved in epidemics of severe gastroenteritis in China, which led to large outbreaks mainly among adults although children were also affected.Studies in the late 1970s and 1980s showed the presence of symptomatic rotavirus infections in adults, particularly in the elderly [Wenman et al., 1979;Cubitt and Holzel, 1980;Marrie et al., 1982;Hrdy, 1987]. Group A rotavirus has also been documented as the cause of adult diarrhea outbreaks in hospitals, nursing homes, travelers, geriatric wards, isolated communities, and families including children and adults participating in playgroup [Bishop, 1994;Kapikian et al., 2001]. In a 4 year study between 1996 and 1999 carried out both on hospitalized and out patients in Japan, group A rotavirus was detected in 97(14%) of 683 adult patients with diarrhea suggesting the importance of this disease in adults may be highly underestimated [Nakajima et al., 2001]. It has been reported that, as children can be infected by rotavirus through older siblings or adults in contact, at times parents may also be infected from children undergoing rotavirus diarrhea due to group A rotavirus [Kapikian et al., 2001].Rotavirus serotypes involved in few outbreaks have been identified in the recent studies. G1 serotype was the etiological agent in an outbreak which lasted for 3 weeks that occurred in a psychiatric nursing home for adults in Hungary [Banyai et al., 2002]. Between November 1998 and December 2000, three/263 gastroenteritis outbreaks among adults in United States were associated with rotavirus serotype G2 [Griffin et al., 2002]. Similarly, the etiological agent responsible for two gastroenteritis outbreaks among children and adults in Japan was serotype G2 [National Institute of Infectious Diseases, 2000a,b]. Rotaviruses were detected in seven gastroenteritis outbreaks, in aged care facilities i...

show abstract

Identification of human and bovine rotavirus serotypes by polymerase chain reaction

Cited by 118 publications

References 33 publications

The detection and molecular characterization of human G12 genotypes in South Africa

The detection and molecular characterization of human G12 genotypes in South Africa

Distinct yearly change of serotype distribution of human rotavirus in Thailand as determined by ELISA and PCR

Dual infection due to simian G3—human reassortant and human G9 strains of rotavirus in a child and subsequent spread of serotype G9, leading to diarrhea among grandparents

Contact Info

Product

Resources

About