Identification ofArcanobacterium pyogenesisolated by post mortem examinations of a bearded dragon and a gecko by phenotypic and genotypic properties

Abstract

The present study was designed to identify phenotypically and genotypically two Arcanobacterium (A.) pyogenes strains isolated by post mortem examinations of a bearded dragon and a gecko. The A. pyogenes strains showed the typical biochemical properties and displayed CAMP-like synergistic hemolytic activities with various indicator strains. The species identity could be confirmed genotypically by amplification and sequencing of the 16S rDNA gene and, as novel target gene, by sequencing of the beta subunit of RNA polymerase encoding gene rpoB, of both strains and of reference strains representing nine species of the genus Arcanobacterium. The species identity of the two A. pyogenes strains could additionally be confirmed by PCR mediated amplification of species specific parts of the 16S-23S rDNA intergenic spacer region, the pyolysin encoding gene plo and by amplification of the collagen-binding protein encoding gene cbpA. All these molecular targets might help to improve the future identification and further characterization of A. pyogenes which, as demonstrated in the present study, could also be isolated from reptile specimens.

Identification of Trueperella pyogenes Isolated from Bovine Mastitis by Fourier Transform Infrared Spectroscopy

“…All T. pyogenes investigated in the present study were identified, comparable to previously described T. pyogenes [5]–[6]–[9], by determination of haemolytic and CAMP-like haemolytic reactions, by using various biochemical tests and genotypically using T. pyogenes specific parts of 16S–23S rDNA intergenic spacer region (ISR) [5] and T. pyogenes specific parts of superoxide dismutase A encoding gene sodA as molecular targets [9]. In addition the amplification of the known and putative virulence factor encoding genes, which had also been previously used to characterize various isolates of this bacterial species [6]–[9], yielded the presence of gene plo encoding pyolysin in 57 isolates, gene cbpA encoding a collagen-binding protein in one isolate, gene nanH encoding neuraminidase H in 39 isolates, gene nanP encoding neuraminidase P in 48 isolates and the fimbriae encoding genes fimA , fimC and fimE in 57, 53 and 52 isolates of the investigated isolates, respectively The phenotypical and genotypical properties are summarized in Table 1.…”

Virulence markers associated with Trueperella pyogenes infections in livestock and companion animals

“…The pyolysin gene ( plo ) was detected using the primer pair and temperature conditions described elsewhere (Ülbegi‐Mohyla et al . ). Briefly, the PCR mixture (20 μ l) contained 0·1 μ mol l −1 of each primer (5′‐CGATCCCTCTGGTGTACTTGC‐3′, forward; 5′‐GCTTGACAAAAATCTGGCGTCC‐3′, reverse), 0·2 mmol l −1 dNTPs (Promega), 1·5 mmol l −1 MgCl 2 (Promega, Madison, WI), Green GoTaq ® Flexi Buffer (Promega), 0·5 U GoTaq ® Flexi DNA Polymerase (Promega) and 1 μ l DNA template.…”

Trueperella pyogenes infections in swine: clinical course and pathology

“…The most typical clinical symptom of overt infection with T. pyogenes for all technological groups is the presence of abscesses in the subcutaneous tissue, organs or within muscles, which are only observable posthumously or during a post-mortem examination (Brinton et al 1993, Lawson et al 2001, Ertas et al 2005, Jost et al 2005, Ide et al 2006, Moore et al 2010, Ü lbegi-Mohyla et al 2010, Shahbazfar et al 2013. A factor that contributes to the development of purulent lesions is the production by T. pyogenes of pyolysine and serine protease.…”